Skip to main content

Table 2 Species-specific and ubiquitous primers for PCR

From: High incidence of Aggregatibacter actinomycetemcomitansinfection in patients with cerebral infarction and diabetic renal failure: a cross-sectional study

Species Primers pairs (5’ to 3’) Amplicon size in bp
Aggregatibacter antinomycetemcomitans AAACCCATCTCTGAGTTCTTCTTC 557
ATGCCAACTTGACGTTAAT  
Porphyromonas gingivalis ACTGTTAGCAACTACCGATGT 404
AGGCAGCTTGCCATACTGCG  
Prevotella intermedia TCAACATCTCTGTATCCTGCGT 575
  TTTGTTGGGGAGTAAAGCGGG  
  1. Abbreviations: PCR polymerase chain reaction.