Skip to main content

Table 2 Nucleotide primer sets used for the ompB LAMP assay

From: Rapid, simple, and sensitive detection of the ompB gene of spotted fever group rickettsiae by loop-mediated isothermal amplification

Primer type Positions Sequence 5-3
FIP(F1c-F2) 1287-1308/1230-1247 GTCACCGCAACATTTGCATCTG-GTAACACTGCAGGTGTGAT
BIP(B1c-B2) 318-1339/1373-1390 TACAGCAATTGAAGCATCAGGT-TCCTAAACGTAACTCGGC
F3 1210-1227 AGGTGATGCTAIIAATCC
B3 1410-1427 CTGTACCITCAGCAAGTT
LF 1263-1285 ACTAGCACTTGCTAAAGTACCGT
LB 1346-1370 GTTGTCCAATTATCAGGAACACATG