Association between Lactobacillus species and bacterial vaginosis-related bacteria, and bacterial vaginosis scores in pregnant Japanese women

  • Renuka Tamrakar1,

    Affiliated with

    • Takashi Yamada1Email author,

      Affiliated with

      • Itsuko Furuta1,

        Affiliated with

        • Kazutoshi Cho1,

          Affiliated with

          • Mamoru Morikawa1,

            Affiliated with

            • Hideto Yamada1,

              Affiliated with

              • Noriaki Sakuragi1 and

                Affiliated with

                • Hisanori Minakami1

                  Affiliated with

                  BMC Infectious Diseases20077:128

                  DOI: 10.1186/1471-2334-7-128

                  Received: 20 February 2007

                  Accepted: 07 November 2007

                  Published: 07 November 2007

                  Abstract

                  Background

                  Bacterial vaginosis (BV), the etiology of which is still uncertain, increases the risk of preterm birth. Recent PCR-based studies suggested that BV is associated with complex vaginal bacterial communities, including many newly recognized bacterial species in non-pregnant women.

                  Methods

                  To examine whether these bacteria are also involved in BV in pregnant Japanese women, vaginal fluid samples were taken from 132 women, classified as normal (n = 98), intermediate (n = 21), or BV (n = 13) using the Nugent gram stain criteria, and studied. DNA extracted from these samples was analyzed for bacterial sequences of any Lactobacillus, four Lactobacillus species, and four BV-related bacteria by PCR with primers for 16S ribosomal DNA including a universal Lactobacillus primer, Lactobacillus species-specific primers for L. crispatus, L. jensenii, L. gasseri, and L. iners, and BV-related bacterium-specific primers for BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium.

                  Results

                  The prevalences of L. crispatus, L. jensenii, and L. gasseri were significantly higher, while those of BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium were significantly lower in the normal group than in the BV group. Unlike other Lactobacillus species, the prevalence of L. iners did not differ between the three groups and women with L. iners were significantly more likely to have BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium. Linear regression analysis revealed associations of BVAB2 and Megasphaera with Nugent score, and multivariate regression analyses suggested a close relationship between Eggerthella-like bacterium and BV.

                  Conclusion

                  The BV-related bacteria, including BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium, are common in the vagina of pregnant Japanese women with BV. The presence of L. iners may be correlated with vaginal colonization by these BV-related bacteria.

                  Background

                  Bacterial vaginosis (BV) is the disturbed vaginal flora, in which normal lactobacilli are replaced by an overgrowth of various anaerobic bacteria [1]. This condition is common in women of reproductive age [1, 2] and may cause malodorous vaginal discharge, although in many women it is asymptomatic [3]. In pregnant women, bacterial vaginosis has been suggested to be a risk factor of perinatal complications, including preterm birth [1, 412] and chorioamnionitis [4, 13]. These complications are closely associated with neonatal morbidity and mortality worldwide.

                  Bacteria detected in BV flora include Gardnerella vaginalis, Mycoplasma hominis, Mobiluncus species (sp.), and other anaerobic bacteria, i.e., Peptostreptococcus sp., Prevotella sp., and Bacteroides sp. [1, 1416]. Recently, bacteria such as Atopobium vaginae, Megasphaera sp., Leptotrichia sp., and Eggerthella-like bacterium have been reported as microorganisms related to this condition by molecular analyses [1719]. Fredricks et al. identified three phylogenetically distinct bacterial DNA sequences in human vaginal samples highly specific for this condition and designated them BV-associated bacteria (BVAB) 1~3 [19]. They showed that BVABs, Megasphaera, Leptotrichia, and Eggerthella-like bacterium are more specific for BV than Gardnerella and Atopobium [19]. Among BVABs, BVAB2 was shown to be more sensitive for BV than BVAB1 and BVAB3, while the specificities of three BVABs were similar [19]. We use the term "BV-related bacteria" for bacteria including BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium in this manuscript. However, it is important to note that these organisms have not been proven to be causative agents of BV.

                  The healthy human vaginal flora in reproductive age is usually predominated by Lactobacillus species. Their metabolic products, such as hydrogen peroxide (H2O2), lactic acid, and bacteriocin are believed to play an important role in maintenance of the normal vaginal flora by inhibiting colonization by other pathogens [2023]. The predominant Lactobacillus species in the normal lactobacillary flora were shown by molecular biological analyses to be L. crispatus, L. gasseri, and L. jensenii [2328]. In recent studies, L. iners described as L. 1086V by Antonio et al. [24] was identified as one of the common Lactobacillus species colonizing the human vagina [18, 2831]. Only 9% of the strains of this species produce H2O2, whereas almost all strains of L. crispatus and L. jensenii produce H2O2 [24].

                  To date, there have been few studies regarding the frequencies of the BV-related bacteria described above and Lactobacillus species in healthy and abnormal vaginal flora in pregnant women. The present study was performed to evaluate the prevalence of the BV-related bacteria and the common Lactobacillus species in normal and BV flora in pregnant Japanese women. We used a specific PCR method targeting the bacterial 16S ribosomal DNA (rDNA) region for this purpose.

                  Methods

                  Patients

                  A total of 163 pregnant Japanese women were enrolled in this study during routine prenatal visits at Hokkaido University Hospital from May 2005 to February 2006. Informed consent was obtained from all participants in verbal form. Vaginal fluid samples were collected at a mean of 23 weeks of gestation. Estimated date of delivery was determined from the last menstrual period and early gestational fetal ultrasonographic measurements.

                  Sample collection, Nugent's scoring, and bacterial culture

                  A sterile speculum was inserted into the vagina and a specimen of vaginal fluid was obtained by brushing the posterior vaginal fornix with a swab. A vaginal smear was prepared by rolling a swab onto a glass slide, which was then air-dried, heat-fixed, and Gram-stained. The smears were then assessed according to Nugent criteria [32]. The other swab was spread onto Columbia blood agar plates, and incubated at 35°C under aerobic conditions in 5% CO2 and anaerobic conditions for 48 h. Lactobacilli were identified to the genus level by Gram staining of colonies and from colony morphology on blood agar plates.

                  DNA extraction and PCR

                  Another swab was placed in 1 ml of PBS with subsequent vigorous vortexing to dislodge cells. The cells were centrifuged at 14,000 rpm for 5 min. The pellet was digested with proteinase K at 56°C for 30–60 min and the DNA was extracted and purified with a QIAmp DNA Mini Kit (Qiagen, Germantown, MD) in accordance with the manufacturer's instructions, resulting in 200 μl of DNA solution. PCR mixtures consisted of PCR buffer with 1.5 mM of MgCl2, 10 pmol of each primer, 2.0 μM of each deoxyribonucleoside triphosphate, 0.1 μl of Taq DNA polymerase, and 1.5 μl of template DNA solution in a final volume of 15 μl.

                  Sequences and annealing temperatures for the various primer sets are listed in Table 1[19, 33]. All primers were located in the 16S rDNA region. PCR was carried out for 40 cycles. For the Lactobacillus genus and its four species, the denaturation was performed at 95°C for 15 s followed by a 1-min annealing and extension step. For four BV-related bacteria, the denaturation step was set at 94°C for 30 s, followed by the annealing step for 30 s for BVAB2, Megasphaera, and Leptotrichia and for 40 s for Eggerthella-like bacterium, with extension at 72°C for 1 min for all reactions. A final extension step at 72°C for 7 min was added for all reactions. Aliquots of 7 μl of the PCR products were electrophoresed in agarose gels and visualized by ultraviolet transillumination after ethidium bromide staining.
                  Table 1

                  PCR primers

                  Name

                  Sequence(5'-3')

                  Target

                  Annealing temperature (°C)

                  Reference

                  LactoF

                  LactoR

                  TGGAAACAGRTGCTAATACCG

                  GTCCATTGTGGAAGATTCCC

                  Lactobacillus

                  62

                  [33]

                  LcrisF

                  LcrisR

                  AGCGAGCGGAACTAACAGATTTAC

                  AGCTGATCATGCGATCTGCTT

                  L. crispatus

                  65

                  [33]

                  LjensF

                  LjensR

                  AAGTCGAGCGAGCTTGCCTATAGA

                  CTTCTTTCATGCGAAAGTAGC

                  L. jensenii

                  60

                  the present study

                  LgassF

                  LgassR

                  AGCGAGCTTGCCTAGATGAATTTG

                  TCTTTTAAACTCTAGACATGCGTC

                  L. gasseri

                  63

                  the present study

                  LinersF

                  LinersR

                  CTCTGCCTTGAAGATCGGAGTGC

                  ACAGTTGATAGGCATCATCTG

                  L. iners

                  65

                  the present study

                  Uncxb2-619F

                  Uncxb2-1024R

                  TTAACCTTGGGGTTCATTACAA

                  AATTCAGTCTCCTGAATCGTCAGA

                  BVAB2

                  55

                  [19]

                  Egger-621F

                  Egger-859R

                  AACCTCGAGCCGGGTTCC

                  TCGGCACGGAAGATGTAATCT

                  Eggerthella-like bacterium

                  58

                  [19]

                  Lepto-395F

                  Lepto-646R

                  CAATTCTGTGTGTGTGAAGAAG

                  ACAGTTTTGTAGGCAAGCCTAT

                  Leptotrichia

                  55

                  [19]

                  MegaE-456F

                  MegaE-667R

                  GATGCCAACAGTATCCGTCCG

                  CCTCTCCGACACTCAAGTTCGA

                  Megasphaera

                  55

                  [19]

                  The specificity of the Lactobacillus species-specific PCR for 14 common intestinal Lactobacillus species was evaluated and confirmed using 106 copies of one Lactobacillus species to each reaction as template DNA (Table 2). The universal Lactobacillus primer amplified all of these Lactobacillus species. The specific primers for L. crispatus, L. jensenii, and L. gasseri only amplified the corresponding species and did not amplify 13 other species (Table 2). They also did not amplify a cloned fragment of 16S rDNA region of L. iners. The specific primers for L. iners did not amplify any of 14 Lactobacillus species (Table 2). We analyzed PCR products from several vaginal samples amplified by the specific primers for L. iners and confirmed that the sequences of PCR products were completely consistent with L. iners (GenBank AY526083).
                  Table 2

                  Bacterial strains and the specificity of primers

                  Species

                  Strain

                  LactoF

                  LcrisF

                  LjensF

                  LgassF

                  LinersF

                    

                  LactoR

                  LcrisR

                  LjensR

                  LgassR

                  LinersR

                  L. crispatus

                  ATCC33197

                  +

                  +

                  -

                  -

                  -

                  L. jensenii

                  ATCC25258

                  +

                  -

                  +

                  -

                  -

                  L. gasseri

                  ATCC 4963

                  +

                  -

                  -

                  +

                  -

                  L. acidophilus

                  ATCC 4356

                  +

                  -

                  -

                  -

                  -

                  L. brevis

                  ATCC 14869

                  +

                  -

                  -

                  -

                  -

                  L. casei

                  ATCC 334

                  +

                  -

                  -

                  -

                  -

                  L. delbrueckii

                  ATCC 11842

                  +

                  -

                  -

                  -

                  -

                  L. fermentum

                  ATCC 14931

                  +

                  -

                  -

                  -

                  -

                  L. johnsonii

                  ATCC 11506

                  +

                  -

                  -

                  -

                  -

                  L. helveticus

                  ATCC 521

                  +

                  -

                  -

                  -

                  -

                  L. plantarum

                  ATCC 8014

                  +

                  -

                  -

                  -

                  -

                  L. reuteri

                  JCM1112

                  +

                  -

                  -

                  -

                  -

                  L. rhamnosus

                  ATCC 7469

                  +

                  -

                  -

                  -

                  -

                  L. salvarius

                  ATCC 11741

                  +

                  -

                  -

                  -

                  -

                  The sensitivities of the species-specific PCR for L. crispatus, L. jensenii, and L. gasseri were measured using serial dilutions of DNA solution of the reference strain. Similarly, for L. iners, serial dilutions of a cloned fragment of 16S rDNA region of L. iners were used instead. The sensitivity of the species-specific PCR for L. crispatus, L. jensenii, and L. gasseri and that of L. iners PCR were 102 to 103 copies and 102 copies per reaction, respectively.

                  Statistical analysis

                  Fisher's exact probability test was used for statistical analysis. Multivariate logistic-regression analysis using SPSS™ for Windows was performed to evaluate the independent risk factors, and P < 0.05 was considered statistically significant.

                  Results

                  Clinical characteristics of women in three groups divided by Nugent score

                  A total of 163 samples from 163 pregnant women were obtained during the study period and 31 samples were excluded because of lack of information regarding the gestational week at delivery (n = 21) or Gram staining (n = 10). The remaining 132 samples from 132 women were analyzed and classified according to the Nugent criteria. Ninety-eight women (74.2%) were classified as having normal vaginal flora, 21 (15.9%) were intermediate, and 13 (9.8%) were BV. Samples from these women were divided into normal, intermediate, and BV groups, respectively.

                  The clinical characteristics of the pregnant women are summarized in Table 3. There were no statistically significant differences in the mean maternal age, number of nulliparous women, gestational week at sampling, gestational week at delivery, or birth weight of the neonate among the three groups. Of the total of 132 women, 35 (26.5%) delivered at <37 weeks, 9 (6.8%) at <33 weeks, and 4 (3.0%) at <30 weeks of gestation.
                  Table 3

                  Demographic and obstetric characteristics of women in normal, intermediate, and BV groups

                   

                  Nugent score

                  0–3

                  4–6

                  7–10

                  No. of women

                  98

                  21

                  13

                  Age (years)

                  32.6 ± 5.3

                  (19–44)

                  32.1 ± 5.8

                  (20–40)

                  29.1 ± 5.3

                  (21–37)

                  Nulliparity (%)

                  46.2

                  52.4

                  50.0

                  Gestational week at sampling

                  22.6 ± 8.6

                  (5–36)

                  23.0 ± 9.1

                  (7–36)

                  24.2 ± 11.2

                  (7–37)

                  Gestational week at delivery

                  37.1 ± 2.9

                  (21–41)

                  36.4 ± 4.7

                  (18–40)

                  37.3 ± 5.5

                  (20–41)

                  Preterm birth at <37 weeks

                  26

                  26.5%

                  7

                  33.3%

                  2

                  15.4%

                  Preterm birth at <33 weeks

                  6

                  6.1%

                  2

                  9.5%

                  1

                  7.7%

                  Preterm birth at <30 weeks

                  2

                  2.0%

                  1

                  4.8%

                  1

                  7.7%

                  Birth weight (g)

                  2807 ± 565

                  (360–3805)

                  2602 ± 794

                  (165–3660)

                  2807 ± 831

                  (350–3555)

                  Range is shown in parenthesis.

                  Detection rate of lactobacilli and BV-related bacteria in three groups by PCR

                  Genus Lactobacillus (any Lactobacillus) was detected in almost all women irrespective of Nugent score (Table 4). The detection rates of L. crispatus, L. jensenii, and L. gasseri were significantly higher in the normal group than in the BV group, while that of L. iners did not differ between the three groups. In contrast, the detection rates of BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium were significantly lower in the normal group than in the BV group.
                  Table 4

                  Distribution of lactobacilli and bacterial vaginosis-related bacteria in women in normal, intermediate, and BV groups determined by PCR

                   

                  Nugent score

                  0–3

                  4–6

                  7–10

                  No. of women

                  98

                  21

                  13

                  any Lactobacillus

                  97(99.0%)

                  21(100.0%)

                  12(92.3%)

                  L. crispatus

                  60(61.2%)

                  6(28.6%)§

                  2(15.4%)§

                  L. jensenii

                  29(29.6%)

                  4(19.0%)

                  0(0.0%)†

                  L. gasseri

                  33(33.7%)

                  9(42.9%)

                  0(0.0%)§

                  L. iners

                  39(39.8%)

                  10(47.6%)

                  6(46.2%)

                  BVAB2

                  3(3.1%)

                  4(19.0%)†

                  5(38.5%)§

                  Megasphaera

                  11(11.2%)

                  13(61.9%)§

                  9(69.2%)§

                  Leptotrichia

                  14(14.3%)

                  5(23.8%)

                  7(53.8%)§

                  Eggerthella-like bacterium

                  7(7.1%)

                  7(33.3%)§

                  7(53.8%)§

                  †: P < 0.05, §: P < 0.01, vs group of Nugent score 0–3

                  Independent risk factors for abnormal Nugent score

                  Multivariate logistic regression analysis was performed to evaluate the independent contributions of the various bacteria to the abnormal vaginal flora (Tables 5 and 6). Seven bacteria, i.e., L. crispatus,L jensenii,L. gasseri, BVAB2, Megasphaera,Leptotrichia and, Eggerthella-like bacterium, were entered as variates to be analyzed (P < 0.1, Fisher's exact probability test). The absence of L. crispatus and the presence of Megasphaera were selected as two independent risk factors of Nugent score ≥ 4, giving Odds ratios of 0.2 and 13.3, respectively (Table 5). Likewise, the presence of Eggerthella-like bacterium was selected as an independent risk factor of Nugent score ≥ 7, giving an Odds ratio of 6.2 (Table 6). Linear regression analyses revealed that BVAB2 and Megasphaera were associated with Nugent score.
                  Table 5

                  Independent risk factors for Nugent score ≥ 4 by multivariate regression analysis

                   

                  β

                  SE

                  p-value

                  Odds (95%CI)

                  Constant

                  -1.32

                  0.35

                    

                  L. crispatus

                  -1.51

                  0.52

                  0.004

                  0.22 (0.08–0.61)

                  Megasphaera

                  2.60

                  0.51

                  0.001

                  13.33 (4.92–36.11)

                  Table 6

                  Independent risk factors for Nugent score ≥ 7 by multivariate regression analysis

                   

                  β

                  SE

                  p-value

                  Odds (95%CI)

                  Constant

                  -2.24

                  0.47

                    

                  Eggerthella-like bacterium

                  1.83

                  0.65

                  0.005

                  6.24 (1.75–22.21)

                  Coexistence of BV-related bacteria with L. iners

                  L. iners was detected by PCR in 55 of 132 (41.7%) women, and its prevalence did not differ between the groups classified according to Nugent score (Table 4). However, the presence of L. iners appeared to be positively associated with colonization by BV-related bacteria (Table 7). The detection rates of all BV-related bacteria were significantly higher in samples harboring L. iners. No such association was seen between the presence or absence of L. iners and the detection rate of any other Lactobacillus species.
                  Table 7

                  Prevalence of various bacteria according to the presence or absence of L. iners

                   

                  L. iners

                  present

                  absent

                  p-value

                  Number

                  55

                  77

                   

                  Lactobacillus

                  55 (100.0%)

                  75 (97.4%)

                  0.510

                  L.crispatus

                  25 (45.5%)

                  43(55.8%)

                  0.290

                  L. jensenii

                  13 (23.6%)

                  20(26.0%)

                  0.840

                  L. gasseri

                  15 (27.3%)

                  27(35.1%)

                  0.449

                  BVAB2

                  11 (20.0%)

                  1 (1.3%)

                  <0.001

                  Megasphaera

                  21 (38.2%)

                  12(15.6%)

                  0.004

                  Leptotrichia

                  19 (34.5%)

                  7(9.1%)

                  <0.001

                  Eggerthella-like bacterium

                  15 (27.3%)

                  6 (7.8%)

                  0.004

                  Difference in the detection of Lactobacillus species between PCR and culture methods

                  Lactobacillus was cultured from 91 (92.9%) of 98 samples, 11 (52.4%) of 21 samples, and 2 (15.4%) of 13 samples of the normal, intermediate, and BV groups, respectively (data not shown). These observations conflicted markedly with the results obtained by the PCR method, especially in women with abnormal vaginal flora with respect to detection of Lactobacillus. Of the eleven women with BV from whom Lactobacillus was uncultured but detected by PCR, L. iners was detected in 5 women and L. crispatus was detected in only one woman by PCR, suggesting that L. iners is less likely to be cultured than L. crispatus. To determine which species of Lactobacillus is difficult to culture, the detection rates by PCR of various species of Lactobacillus were compared with those by the conventional culture method (Table 8). Among 130 samples determined to contain any Lactobacillus by the PCR method, 104 (80.0%) were positive for Lactobacillus by the culture method (Table 8). More than 90% of samples determined to contain L. crispatus, L. jensenii, or L. gasseri by the PCR method were determined to have Lactobacillus by the conventional culture method. Among 24 samples in which L. crispatus was the only Lactobacillus species identified by the PCR method, Lactobacillus was cultured from 22 samples (91.7%), while Lactobacillus was cultured only from 47.6% and 27.3% of samples in which L. iners and unspecified Lactobacillus species, respectively, were the only Lactobacillus species identified by the PCR method. Thus, L. iners, and unspecified Lactobacillus species other than L. crispatus, L. jensenii, or L. gasseri appeared to have stringent cultivation requirements.
                  Table 8

                  Differences in detection between PCR and cultivation methods

                   

                  PCR

                  CULTURE

                  CULTURE/PCR(%)

                  any Lactobacillus

                  130

                  104

                  80.0%

                  L. crispatus

                  68

                  63

                  92.6%

                  L. jensenii

                  33

                  32

                  97.0%

                  L. gasseri

                  42

                  39

                  92.9%

                  L. iners

                  55

                  41

                  74.5%

                  L. crispatus only

                  24

                  22

                  91.7%§

                  L. jensenii only

                  5

                  4

                  80.0%§

                  L. gasseri only

                  14

                  13

                  92.9%§

                  L. iners only

                  21

                  10

                  47.6%§

                  Lactobacillus, unspecified spp.only

                  11

                  3

                  27.3%§

                  §P < 0.01

                  Number of samples in which lactobacillus species were detected.

                  Discussion

                  In the present study, we confirmed that L. crispatus, L. gasseri, and L. jensenii were common species in pregnant Japanese women with normal vaginal flora by species-specific PCR of the 16S rDNA region. These three species were less prevalent in women with BV. In contrast, four BV-related bacteria, i.e., BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium, were detected at higher prevalence in women with BV. As all these results were in accordance with those of Fredricks et al. [19] who analyzed the vaginal fluid of non-pregnant women with and without BV using the broad-range 16S rDNA PCR and cloning methods, BV is suggested to have remarkably similar microbiological profiles among women with different demographic characteristics, including race and pregnancy, as suggested by the conventional cultivation method.

                  L. crispatus, L. gasseri, and L. jensenii are common Lactobacillus species found in the vagina [2428, 31, 34]. L. iners, described recently as a new Lactobacillus species [29], is one of the common Lactobacillus species of the vaginal microbiota [18, 19, 23, 28, 30, 31], which was also confirmed in the present study. The results showed that L. iners was present in 40% to 50% of women irrespective of Nugent score, as observed in an earlier study [19]. We examined twelve samples positive for L. iners (6 from normal flora and 6 from BV flora) to determine whether the abundance of L. iners was different in the two groups. The species-specific PCR for L. iners using serial dilutions of each sample revealed that both normal and BV flora contained 103 to 105 copies/μl of L. iners and the median concentration was 104 copies/μl for both.

                  As the presence of H2O2-producing lactobacilli in the vaginal fluid is associated with a reduced risk of BV [15, 24] and because the concentration of H2O2 in the vaginal fluid is low in women with BV as compared with those with normal vaginal flora [21], the H2O2-producing ability of lactobacilli is thought to play a significant role in protecting the vaginal ecosystem from BV infection, although direct evidence to support this notion is lacking. Nearly all strains of L. crispatus and L. jensenii have been reported to produce H2O2, whereas only 9% of the strains of L. iners produce H2O2 [24]. The prevalences of L. crispatus and L. jensenii were significantly higher in the normal group than in the BV group and the detection rates of all BV-related bacteria were significantly higher in women with than in those without L. iners in this study. Although this observation is consistent with the notion that H2O2-producing ability of lactobacilli is important in protecting the vaginal ecosystem from BV infection, it remains to be determined whether these observations resulted from differences in H2O2-producing ability of these lactobacilli.

                  The newly proposed "BV-related bacteria," including BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium, were all shown to be associated with BV in the present study, confirming the results of a recent study by Fredricks et al. [19]. However, the detection rates of these bacteria in women with BV were lower, while those in women with normal flora were similar to their results [19]. BVAB2 is cultivation-resistant, one of three bacteria (provisionally named BV-associated bacteria: BVAB1, BVAB2, and BVAB3) newly found to be highly specific for BV in the vagina of non-pregnant women [19], and not closely related to other bacteria as shown by comparison of 16S rDNA. In the present study, BVAB2 was present in 38.5% (5/13) and 3.1% (3/98) of women with BV and with normal vaginal flora, respectively, while Fredricks et al. reported these rates to be 88.9% (24/27) and 4.3% (2/46), respectively [19]. Similarly, detection rates of Megasphaera (69.2%),Eggerthella-like bacterium (53.8%), and Leptotrichia (53.8%) in women with BV in the present study were lower than those of 96.3%, 92.6%, and 85.2% reported by Fredricks et al. [19], while detection rates of Megasphaera (11.2%),Eggerthella-like bacterium (7.1%), and Leptotrichia (14.3%) in women with normal vaginal flora were comparable to their values of 8.7%, 8.7%, and 4.3%, respectively [19].

                  The results of the present study raised the possibility that the four BV-related bacteria were less prevalent in pregnant Japanese women with BV as compared with non-pregnant American women. However, the number of subjects with BV in the present study was too low to draw definitive conclusions about the prevalence of bacteria in different populations. Further studies using different demographic populations are needed to determine the roles of these BV-related bacteria in the pathogenesis of BV.

                  Twelve (92%) of 13 women with BV were positive for genus Lactobacillus by 16S rDNA PCR using the universal Lactobacillus primer, including 5 women with L. iners, one with both L. iners and L. crispatus, one with L. crispatus, and 5 with unspecified Lactobacillus. Of these 13 women, only one with L. iners was positive for Lactobacillus by general cultivation methods and positive for Gram-positive rods on Gram staining. These results suggested that many women with BV harbor genus Lactobacillus in the vagina and that the number of these lactobacilli colonizing the vagina is small. Further, as L. iners has been reported to require specialized blood agar media for isolation [29], the conventional culture method used in this study may have failed to reveal its colonization in the vagina.

                  Conclusion

                  Our results suggested that BV-related bacteria, including BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium, were associated with BV in pregnant Japanese women. The presence of L. iners, one of the common Lactobacillus species in the vagina, may be correlated with vaginal colonization by these BV-related bacteria. It remains to be determined whether BV-related bacteria cause BV or are common and abundant as a consequence of BV.

                  Declarations

                  Acknowledgements

                  The authors would like to thank Takahiro Yamada, Mashiho Minami, and Ayano Yamazaki for sample collection, and Hirotsugu Akisawa for reading gram staining results and bacterial cultures. Renuka Tamrakar is supported by Sato International Scholarship Foundation.

                  Authors’ Affiliations

                  (1)
                  Department of Obstetrics and Gynecology, Hokkaido University Graduate School of Medicine

                  References

                  1. Sobel JD: Bacterial vaginosis. Annu Rev Med 2000, 51:349–356.PubMedView Article
                  2. Wang J: Bacterial vaginosis. Prim Care Update Ob Gyns 2000, 7:181–185.PubMedView Article
                  3. Burton JP, Reid G: Evaluation of the bacterial vaginal flora of 20 postmenopausal women by direct (Nugent score) and molecular (polymerase chain reaction and denaturing gradient gel electrophoresis) techniques. J Infect Dis 2002, 186:1770–1780.PubMedView Article
                  4. Gravett MG, Hummel D, Eschenbach DA, Holmes KK: Preterm labor associated with subclinical amniotic fluid infection and with bacterial vaginosis. Obstet Gynecol 1986, 67:229–237.PubMedView Article
                  5. Krohn MA, Hillier SL, Lee ML, Rabe LK, Eschenbach DA: Vaginal Bacteroides species are associated with an increased rate of preterm delivery among women in preterm labor. J Infect Dis 1991, 164:88–93.PubMedView Article
                  6. McDonald HM, O'Loughlin JA, Jolley P, Vigneswaran R, McDonald PJ: Vaginal infection and preterm labour. Br J Obstet Gynaecol 1991, 98:427–435.PubMedView Article
                  7. Holst E, Goffeng AR, Andersch B: Bacterial vaginosis and vaginal microorganisms in idiopathic premature labor and association with pregnancy outcome. J Clin Microbiol 1994, 32:176–186.PubMed
                  8. Hay PE, Lamont RF, Taylor-Robinson D, Morgan DJ, Ison C, Pearson J: Abnormal bacterial colonisation of the genital tract and subsequent preterm delivery and late miscarriage. BMJ 1994, 308:295–298.PubMed
                  9. Hillier SL, Nugent RP, Eschenbach DA, Krohn MA, Gibbs RS, Martin DH, Cotch MF, Edelman R, Pastorek JG 2nd, Rao AV, McNellis D, Regan JA, Carey JC, Klebanoff MA: Association between bacterial vaginosis and preterm delivery of a low-birth-weight infant. The Vaginal Infections and Prematurity Study Group. N Engl J Med 1995, 333:1737–1742.PubMedView Article
                  10. Subtil D, Denoit V, Goueff FL, Husson MO, Trivier D, Puech F: The role of bacterial vaginosis in preterm labor and preterm birth: a case-control study. Eur J Obstet Gynecol Reprod Biology 2002, 101:41–46.View Article
                  11. Usui R, Ohkuchi A, Matsubara S, Izumi A, Watanabe T, Suzuki M, Minakami H: Vaginal lactobacilli and preterm birth. J Perinat Med 2002, 30:458–466.PubMedView Article
                  12. Leitich H, Bodner-Adler B, Brunbauer M, Kaider A, Egarter C, Husslein P: Bacterial vaginosis as a risk factor for preterm delivery: A meta-analysis. Am J Obstet Gynecol 2003, 189:139–147.PubMedView Article
                  13. Hillier SL, Martius J, Krohn M, Kiviat N, Holmes KK, Eschenbach DA: A case-control study of chorioamnionic infection and histologic chorioamnionitis in prematurity. N Engl J Med 1988, 319:972–978.PubMedView Article
                  14. Hill GB: The microbiology of bacterial vaginosis. Am J Obstet Gynecol 1993, 169:450–454.PubMed
                  15. Hillier SL, Krohn MA, Rabe LK, Klebanoff SJ, Eschenbach DA: The normal vaginal flora, H2O2-producing lactobacilli, and bacterial vaginosis in pregnant women. Clin Infec Dis 1993, 16:S273–81.View Article
                  16. Thorsen P, Jensen IP, Jeune B, Ebbesen N, Arpi M, Bremmelgaard A, Moller BR: Few microorganisms associated with bacterial vaginosis may constitute the pathologic core: A population-based microbiologic study among 3596 pregnant women. Am J Obstet Gynecol 1998, 178:580–587.PubMedView Article
                  17. Ferris MJ, Masztal A, Aldridge KE, Fortenberry JD, Fidel PL Jr, Martin DH: Association of Atopobium vaginae , a recently described metronidazole resistant anaerobe, with bacterial vaginosis. BMC Infect Dis 2004, 4:5.PubMedView Article
                  18. Zhou X, Bent SJ, Schneider MG, Davis CC, Islam MR, Forney LJ: Characterization of vaginal microbial communities in adult healthy women using cultivation-independent methods. Microbiology 2004, 150:2565–2573.PubMedView Article
                  19. Fredricks DN, Fiedler TL, Marrazzo JM: Molecular identification of bacteria associated with bacterial vaginosis. N Eng J Med 2005, 353:1899–1911.View Article
                  20. Klebanoff SJ, Hillier SL, Eschenbach DA, Waltersdorph AM: Control of the microbial flora of the vagina by H2O2-generating lactobacilli. J Infect Dis 1991, 164:94–100.PubMedView Article
                  21. Al-Mushrif S, Jones BM: A study of the prevalence of hydrogen peroxide generating Lactobacilli in bacterial vaginosis: the determination of H2O2 concentrations generated, in vitro , by isolated strains and the levels found in vaginal secretions of women with and without infection. J Obstet Gynaecol 1998, 18:63–67.PubMedView Article
                  22. Onderdonk AB, Lee ML, Lieberman E, Delaney ML, Tuomala RE: Quantitative microbiologic models for preterm delivery. J Clin Microbiol 2003, 41:1073–1079.PubMedView Article
                  23. Wilks M, Wiggins R, Whiley A, Hennessy E, Warwick S, Porter H, Corfield A, Millar M: Identification and H2O2 production of vaginal lactobacilli from pregnant women at high risk of preterm birth and relation with outcome. J Clin Microbiol 2004, 42:713–717.PubMedView Article
                  24. Antonio MAD, Hawes SE, Hillier SL: The identification of vaginal Lactobacillus species and the demographic and microbiologic characteristics of women colonized by these species. J Infect Dis 1999, 180:1950–1956.PubMedView Article
                  25. Song YL, Kato N, Matsumiya Y, Liu CX, Kato H, Watanabe K: Identification of and hydrogen peroxide production by fecal and vaginal lactobacilli isolated from Japanese women and newborn infants. J Clin Microbiol 1999, 37:3062–3064.PubMed
                  26. Vallor AC, Antonio MAD, Hawes SE, Hillier SL: Factors associated with acquisition of, or persistent colonization by, vaginal lactobacilli: Role of hydrogen peroxide production. J Infect Dis 2001, 184:1431–1436.PubMedView Article
                  27. Pavlova SI, Kilic AO, Kilic SS, So JS, Nader-Macias ME, Simoes JA, Tao L: Genetic diversity of vaginal lactobacilli from women in different countries based on 16S rRNA gene sequences. J Appl Microbiol 2002, 92:451–459.PubMedView Article
                  28. Vasquez A, Jakobsson T, Ahrne S, Forsum U, Molin G: Vaginal Lactobacillus flora of healthy Swedish women. J Clin Microbiol 2002, 40:2746–2749.PubMedView Article
                  29. Falsen E, Pascual C, Sjoden B, Ohlen M, Collins MD: Phenotypic and phylogenetic characterization of a novel Lactobacillus species from human sources: description of Lactobacillus iners sp. nov. Int J Syst Bacteriol 1999, 49:217–221.PubMedView Article
                  30. Burton JP, Cadieux PA, Reid G: Improved understanding of the bacterial vaginal microbiota of women before and after probiotic instillation. Appl Environ Microbiol 2003, 69:97–101.PubMedView Article
                  31. Antonio MAD, Rabe LK, Hillier SL: Colonization of the rectum by Lactobacillus species and decreased risk of bacterial vaginosis. J Infect Dis 2005, 192:394–398.PubMedView Article
                  32. Nugent RP, Krohn MA, Hillier SL: Reliability of diagnosing bacterial vaginosis is improved by a standardized method of Gram stain interpretation. J Clin Microbiol 1991, 29:297–301.PubMed
                  33. Byun R, Nadkarni MA, Chhour KL, Martin FE, Jacques NA, Hunter N: Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. J Clin Microbiol 2004, 42:3128–3136.PubMedView Article
                  34. Giorgi A, Torriani S, Dellaglio F, Bo G, Stola E, Bernuzzi L: Identification of vaginal lactobacilli from asymptomatic women. Microbiologica 1987, 10:377–384.PubMed
                  35. Pre-publication history

                    1. The pre-publication history for this paper can be accessed here:http://​www.​biomedcentral.​com/​1471-2334/​7/​128/​prepub

                  Copyright

                  © Tamrakar et al. 2007

                  This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.