Comparative evaluation of three immunochromatographic identification tests for culture confirmation of Mycobacterium tuberculosis complex

  • Kinuyo Chikamatsu1Email author,

    Affiliated with

    • Akio Aono1,

      Affiliated with

      • Hiroyuki Yamada1,

        Affiliated with

        • Tetsuhiro Sugamoto1,

          Affiliated with

          • Tomoko Kato1, 2,

            Affiliated with

            • Yuko Kazumi1,

              Affiliated with

              • Kiyoko Tamai3,

                Affiliated with

                • Hideji Yanagisawa3 and

                  Affiliated with

                  • Satoshi Mitarai1, 2

                    Affiliated with

                    BMC Infectious Diseases201414:54

                    DOI: 10.1186/1471-2334-14-54

                    Received: 21 August 2013

                    Accepted: 27 January 2014

                    Published: 1 February 2014

                    Abstract

                    Background

                    The rapid identification of acid-fast bacilli recovered from patient specimens as Mycobacterium tuberculosis complex (MTC) is critically important for accurate diagnosis and treatment. A thin-layer immunochromatographic (TLC) assay using anti-MPB64 or anti-MPT64 monoclonal antibodies was developed to discriminate between MTC and non-tuberculosis mycobacteria (NTM). Capilia TB-Neo, which is the improved version of Capilia TB, is recently developed and needs to be evaluated.

                    Methods

                    Capilia TB-Neo was evaluated by using reference strains including 96 Mycobacterium species (4 MTC and 92 NTM) and 3 other bacterial genera, and clinical isolates (500 MTC and 90 NTM isolates). M. tuberculosis isolates tested negative by Capilia TB-Neo were sequenced for mpt64 gene.

                    Results

                    Capilia TB-Neo showed 100% agreement to a subset of reference strains. Non-specific reaction to M. marinum was not observed. The sensitivity and specificity of Capilia TB-Neo to the clinical isolates were 99.4% (99.6% for M. tuberculosis, excluding M. bovis BCG) for clinical MTC isolates and 100% for NTM isolates tested, respectively. Two M. tuberculosis isolates tested negative by Capilia TB-Neo: one harbored a 63-bp deletion in the mpt64 gene and the other possessed a 3,659-bp deletion from Rv1977 to Rv1981c, a region including the entire mpt64 gene.

                    Conclusions

                    Capilia TB-Neo is a simple, rapid and highly sensitive test for identifying MTC, and showed better specificity than Capilia TB. However, Capilia TB-Neo still showed false-negative results with mpt64 mutations. The limitation should be recognized for clinical use.

                    Keywords

                    Capilia TB-Neo Mycobacterium tuberculosis complex identification mpt64 gene

                    Background

                    Tuberculosis remains a major threat to global health, and therefore, rapid identification of the causative M. tuberculosis complex (MTC) is critical. Liquid culture detection is now widely used for managing HIV-co-infected and drug-resistant tuberculosis, and liquid culture can improve the recovery of acid-fast bacilli and decreases the time to detection. However, because other non-tuberculosis mycobacterium (NTM) species may also grow, it is important to identify MTC from positive culture for rapid and appropriate management of tuberculosis.

                    Several methods are available to identify mycobacteria. Conventional biochemical tests are generally time-consuming [1, 2] and not surely reproducible, while more recently developed techniques involving molecular biology [37] or high-performance liquid chromatographic analysis of mycolic acid [8] are accurate and rapid, but these require expensive devices. In contrast, immunochromatographic species identification tests, Capilia TB (TAUNS, Izunokuni, Japan), SD BIOLINE TB Ag MPT64 rapid (Standard Diagnostics, Inc., Korea) and BD MGIT™ TBc Identification Test (Becton, Dickinson and Company, USA) have been adopted as a cheap, rapid, and accurate alternative in clinical laboratories around the world [911]. However, false positives to Mycobacterium marinum, Staphylococcus aureus[9, 12], and false negatives in MPB64 mutants [10, 13] have occasionally been reported. Capilia TB-Neo (TAUNS, Izunokuni, Japan), an improved version of Capilia TB, has recently been developed to overcome these problems. In this study, we evaluated the performance of Capilia TB-Neo with reference strains and clinical isolates. Any false-negative MTC clinical isolate detected by Capilia TB-Neo were further investigated relative genes.

                    Methods

                    Reference strains and clinical isolates

                    Reference strains of 96 Mycobacterium species and subspecies (4 MTC and 92 NTM) and 3 other genera with acid-fastness (Nocardia asteroids, Rhodococcus equi and Rhodococcus aichiense) were used for the evaluation (Table 1). A total of 500 MTC and 90 NTM clinical isolates (10 M. abscessus, 4 M. chelonae, 13 M. fortuitum, 8 M. gordonae, 15 M. avium complex, 7 M. intracellulare, 3 M. nonchromogenicum, 5 M. scrofulaceum, 4 M. xenopi, 15 M. kansasii, 1 M. gastri, 2 M. peregrinum, 1 M. intermedium, 1 M. szulgai, and 1 M. marinum) were selected to provide a representative sample of the isolates available from Miroku Medical Laboratory Co., Ltd. (Saku, Japan) from 2009 to 2010, and the collection from the Ryoken survey in 2002 and 2007. The clinical isolates were collected from patients as a part of routine examination. No ethical approval was required for this type of laboratory based study only using isolates. Reference strains and clinical isolates were cultured with OADC-supplemented Middlebrook 7H9 broth (Becton, Dickinson and Company, USA) and 2% Ogawa medium (Kyokuto Pharmaceutical Industrial Co., Japan) at 37°C or 30°C.
                    Table 1

                    List of reference strains and the results of identification of MTC by using Capilia TB-Neo, SD MPT64, and TBc ID

                    Species

                    Strain

                    Capilia TB-Neo

                    SD MPT64

                    TBc ID

                    Species

                    Strain

                    Capilia TB-Neo

                    SD MPT64

                    TBc ID

                    M. tuberculosis H37Rv

                    ATCC27294

                    +

                    +

                    +

                    M. interjectum

                    ATCC51457

                    -

                    -

                    -

                    M. africanum

                    ATCC25420

                    +

                    +

                    +

                    M. intermedium

                    ATCC51848

                    -

                    -

                    -

                    M. bovis

                    ATCC19210

                    +

                    +

                    +

                    M. intracellulare

                    ATCC13950

                    -

                    -

                    -

                    M. microti

                    ATCC19422

                    +

                    +

                    +

                    M. kansasii

                    ATCC12478

                    -

                    -

                    -

                    M. abscessus

                    ATCC19977

                    -

                    -

                    -

                    M. kubicae

                    ATCC700732

                    -

                    -

                    -

                    M. acapulcensis

                    ATCC14473

                    -

                    -

                    -

                    M. lactis

                    ATCC27356

                    -

                    -

                    -

                    M. agri

                    ATCC27406

                    -

                    -

                    -

                    M. lentiflavum

                    ATCC51985

                    -

                    -

                    -

                    M. aichiense

                    ATCC27280

                    -

                    -

                    +

                    M. madagascariense

                    ATCC49865

                    -

                    -

                    -

                    M. alvei

                    ATCC51304

                    -

                    -

                    -

                    M. malmoense

                    ATCC29571

                    -

                    -

                    -

                    M. asiaticum

                    ATCC25276

                    -

                    -

                    -

                    M. marinum

                    ATCC00927

                    -

                    -

                    +

                    M. aurum

                    ATCC23366

                    -

                    -

                    -

                    M. moriokaense

                    ATCC43059

                    -

                    -

                    -

                    M. austroafricanum

                    ATCC33464

                    -

                    -

                    -

                    M. mucogenicum

                    ATCC49650

                    -

                    -

                    -

                    M. avium subsp. avium

                    ATCC25291

                    -

                    -

                    -

                    M. neoaurum

                    ATCC25795

                    -

                    -

                    -

                    M. avium subsp. paratuberculosis

                    ATCC19698

                    -

                    -

                    -

                    M. nonchromogenicum

                    ATCC19530

                    -

                    -

                    -

                    M. avium subsp. “suis”

                    ATCC19978

                    -

                    -

                    -

                    M. novum

                    ATCC19619

                    -

                    -

                    -

                    M. avium subsp. silvaticum

                    ATCC49884

                    -

                    -

                    -

                    M. obuense

                    ATCC27023

                    -

                    -

                    -

                    M. branderi

                    ATCC51789

                    -

                    -

                    -

                    M. paraffinicum

                    ATCC12670

                    -

                    -

                    -

                    M. brumae

                    ATCC51384

                    -

                    +

                    -

                    M. parafortuitum

                    ATCC19686

                    -

                    -

                    -

                    M. celatum

                    ATCC51131

                    -

                    -

                    -

                    M. peregrinum

                    ATCC14467

                    -

                    -

                    -

                    M. celatum II

                    ATCC51130

                    -

                    -

                    -

                    M. petroleophilum

                    ATCC21497

                    -

                    -

                    -

                    M. chelonae chemovar niacinogenes

                    ATCC35750

                    -

                    -

                    -

                    M. phlei

                    ATCC11758

                    -

                    -

                    -

                    M. chelonae subsp. chelonae

                    ATCC35752

                    -

                    -

                    -

                    M. porcinum

                    ATCC33776

                    -

                    -

                    -

                    M. chitae

                    ATCC19627

                    -

                    -

                    +

                    M. poriferae

                    ATCC35087

                    -

                    -

                    -

                    M. chlorophenolicum

                    ATCC49826

                    -

                    -

                    -

                    M. pulveris

                    ATCC35154

                    -

                    -

                    -

                    M. chubuense

                    ATCC27278

                    -

                    -

                    -

                    M. rhodesiae

                    ATCC27024

                    -

                    -

                    -

                    M. confluentis

                    ATCC49920

                    -

                    -

                    -

                    M. scrofulaceum

                    ATCC19981

                    -

                    -

                    -

                    M. conspicuum

                    ATCC700090

                    -

                    -

                    -

                    M. senegalense

                    ATCC35796

                    -

                    -

                    -

                    M. cookii

                    ATCC49103

                    -

                    -

                    -

                    M. septicum

                    ATCC700731

                    -

                    -

                    -

                    M. diernhoferi

                    ATCC19340

                    -

                    -

                    -

                    M. shimoidei

                    ATCC27962

                    -

                    -

                    -

                    M. duvalii

                    ATCC43910

                    -

                    -

                    -

                    M. shinshuense

                    ATCC33728

                    -

                    -

                    -

                    M. engbaekii

                    ATCC27353

                    -

                    -

                    -

                    M. simiae

                    ATCC25275

                    -

                    -

                    -

                    M. flavescens

                    ATCC14474

                    -

                    -

                    -

                    M. smegmatis

                    ATCC19420

                    -

                    -

                    -

                    M. fortuitum subsp. acetamidolyticum

                    ATCC35931

                    -

                    -

                    -

                    M. smegmatis

                    ATCC700084

                    -

                    -

                    -

                    M. fortuitum subsp. fortuitum

                    ATCC06841

                    -

                    -

                    -

                    M. sphagni

                    ATCC33027

                    -

                    -

                    -

                    M. fortuitum subsp. fortuitum

                    ATCC49403

                    -

                    -

                    -

                    M. szulgai

                    ATCC35799

                    -

                    -

                    -

                    M. gadium

                    ATCC27726

                    -

                    -

                    +

                    M. terrae

                    ATCC15755

                    -

                    -

                    -

                    M. gallinarum

                    ATCC19710

                    -

                    -

                    -

                    M. terrae

                    DSMZ43540

                    -

                    -

                    -

                    M. genavense

                    ATCC51234

                    -

                    -

                    -

                    M. terrae

                    DSMZ43541

                    -

                    -

                    -

                    M. gilvum

                    ATCC43909

                    -

                    -

                    -

                    M. terrae

                    DSMZ43542

                    -

                    -

                    -

                    M. goodii

                    ATCC700504

                    -

                    -

                    -

                    M. thermoresistibile

                    ATCC19527

                    -

                    -

                    -

                    M. gordonae

                    ATCC14470

                    -

                    -

                    -

                    M. tokaiense

                    ATCC27282

                    -

                    -

                    -

                    M. gordonae group B 19

                    KK33-08

                    -

                    -

                    -

                    M. triplex

                    ATCC700071

                    -

                    -

                    -

                    M. gordonae group C 19

                    KK33-53

                    -

                    -

                    -

                    M. triviale

                    ATCC23292

                    -

                    -

                    -

                    M. gordonae group D 19

                    KK33-46

                    -

                    -

                    -

                    M. vaccae

                    ATCC15483

                    -

                    -

                    -

                    M. haemophilum

                    ATCC29548

                    -

                    -

                    -

                    M. valentiae

                    ATCC29356

                    -

                    -

                    -

                    M. hassiacum

                    ATCC700660

                    -

                    -

                    -

                    M. wolinskyi

                    ATCC700010

                    -

                    -

                    -

                    M. heckeshornense

                    DSMZ44428

                    -

                    -

                    -

                    M. xenopi

                    ATCC19250

                    -

                    -

                    -

                    M. heidelbergense

                    ATCC51253

                    -

                    -

                    -

                    Nocardia asteroides

                    ATCC19247

                    -

                    -

                    -

                    M. hiberniae

                    ATCC49874

                    -

                    -

                    -

                    Rhodococcus equi

                    ATCC6939

                    -

                    -

                    -

                         

                    Rhodococcus aichiense

                    ATCC33611

                    -

                    -

                    -

                    Identification of mycobacteria

                    Mycobacterium species of the clinical isolates were identified using one or more of the following approaches: (i) the DNA or RNA amplification kits Cobas Amplicor PCR (Roche Diagnostics, Japan) and TRC Rapid (Tosoh Bioscience, Japan); (ii) the DNA-DNA hybridization DDH Mycobacteria Kit (Kyokuto Pharmaceutical Industrial Co., Japan); and (iii) 16S rRNA gene sequencing, supplementary [7]. The isolates identified as MTC were further examined by multiplex PCR analysis of cfp32, the region of difference (RD) 9, and RD12 according to the method of Nakajima et al. [14]. When MTC species other than M. tuberculosis sensu stricto were detected, they were further characterized with respect to RD1, RD4, RD7, and MiD3 [15]. If M. bovis Bacillus Calmette-Guerin (BCG) was identified, additional multiplex PCR analyses were performed to test for RD2, RD14, RD15, RD16, and SenX3-RegX3 to distinguish sub-strains of BCG [16, 17]. The multiplex PCR amplification was performed using a Type-it Microsatellite PCR Kit (QIAGEN, Japan). Each PCR reaction contained 1.0 μl of DNA template, 6.25 μl of Type-it multiplex PCR Master mix, 1.25 μl of Q-solution, 0.25 μl of each primer (10 pmol/μl) and an appropriate amount of molecular grade water for a total reaction volume of 13 μl. The thermal profile was as follows: (i) 95°C (5 min); (ii) 28 cycles of 95°C (0.5 min), 58 or 55°C (1.5 min), 72°C (0.5 min); and (iii) a final extension step at 68 or 60°C (10 or 30 min). The amplified products were analyzed by 3% agarose gel electrophoresis. The expected RD loci for each MTC species are summarized in Table 2.
                    Table 2

                    Oligonucleotide primers used in PCR and direct sequencing

                    Target gene

                    Primer ID

                    Nucleotide sequence (5'-3')

                    Size (bp)

                    Ref. no.

                    MTC identification

                        

                     16S rRNA

                    285

                    GAGAGTTTGATCCTGGCTCAG

                    1028

                    7

                     

                    264

                    TGCACACAGGCCACAAGGGA

                      
                     

                    259

                    TTTCACGAACAACG GACAA

                    591

                     

                    cfp32

                    Rv0577F

                    ATGCCCAAGAGAAGCGAATACAGGCAA

                    786

                    14

                     

                    Rv0577R

                    CTATTGCTGCGGTGCGGGCTTCAA

                      

                     RD9

                    Rv2073cF

                    TCGCCGCTGCCAGATGAGTC

                    600

                    14

                     

                    Rv2073cR

                    TTTGGGAGCCGCCGGTGGTGATGA

                      

                     RD12

                    Rv3120F

                    GTCGGCGATAGACCATGAGTCCGTCTCCAT

                    404

                    14

                     

                    Rv3120R

                    GCGAAAAGTGGGCGGATGCCAG

                      

                     RD1

                    ET1

                    AAGCGGTTGCCGCCGACCGACC

                     

                    15

                     

                    ET2

                    CTGGCTATATTCCTGGGCCCGG

                      
                     

                    ET3

                    GAGGCGATCTGGCGGTTTGGGG

                      

                     RD4

                    Rv1510F

                    GTGCGCTCCACCCAAATAGTTGC

                    1033

                    15

                     

                    Rv1510R

                    TGTCGACCTGGGGCACAAATCAGTC

                      

                     RD7

                    Rv1970F

                    GCGCAGCTGCCGGATGTCAAC

                    1116

                    15

                     

                    Rv1970R

                    CGCCGGCAGCCTCACGAAATG

                      

                     MiD3

                    IS1561F

                    GCTGGGTGGGCCCTGGAATACGTGAACTCT

                    530

                    15

                     

                    IS1561R

                    AACTGCTCACCCTGGCCACCACCATGGACT

                      

                    Distinguish sub-strains of BCG

                       

                     RD2

                    RD2l

                    CCAGATTCAAATGTCCGACC

                     

                    16

                     

                    RD2r

                    GTGTCATAGGTGATTGGCTT

                      

                     RD14

                    RD14l

                    CAGGGTTGAAGGAATGCGTGTC

                     

                    16

                     

                    RD14r

                    CTGGTACACCTGGGGAATCTGG

                      

                     RD15

                    RD8l

                    ACTCCTAGCTTTGCTGTGCGCT

                     

                    16

                     

                    RD8r

                    GTACTGCGGGATTTGCAGGTTC

                      

                     RD16

                    RD16nf

                    ACATTGGGAAATCGCTGCTGTTG

                     

                    17

                     

                    RD16nr

                    GGCTGGTGTTTCGTCACTTC

                      

                    SenX3-RegX3

                    C3

                    GCGCGAGAGCCCGAACTGC

                     

                    16

                     

                    C5

                    GCGCAGCAGAAACGTCAGC

                      

                    Sequencing

                        

                    mpt64 (Rv1980c)

                    mpb64W-F

                    ACTCAGATATCGCGGCAATC

                    1061

                    this study

                     

                    mpb64W-R

                    CGATCACCTCACCTGGAGTT

                      

                     Rv1977

                    Rv1977F

                    GTTTCCCGAGATCAGCTCAA

                    348

                    this study

                     

                    Rv1977R

                    ATCTCGTCGTGTGTCACCAG

                      

                     Rv1981c

                    Rv1981F

                    GATCGAATGCAGGCTGGTAT

                    399

                    this study

                     

                    Rv1981R

                    ACTACTACCGCGGTGACGAC

                      

                    Capilia TB-Neo, SD MPT64, and TBc ID

                    The validation of Capilia TB-Neo (TAUNS, Izunokuni, Japan) was conducted using the aforementioned reference strains as well as MTC and NTM clinical isolates. In addition, SD BIOLINE TB Ag MPT64 rapid (SD MPT64: Standard Diagnostics, Inc. Korea) and BD MGIT™ TBc Identification Test (TBc ID: Becton, Dickinson and Company, USA), detect MPT64 which is the same as MPB64, were tested using reference strains and NTM clinical isolates. Each test was performed according to the manufacturer’s instructions. Briefly, clinical isolates growing on Ogawa medium were suspended in 1 ml of sterile distilled water, and the suspension subjected to the test. Similarly, positive liquid cultures of reference strains (McFarland No. 1 to 2) were directly subjected to each test. Positive test results were indicated by a red line in the test area after 15 min.

                    Sequencing of the mpt64 gene

                    Any false-negative M. tuberculosis isolate detected by Capilia TB-Neo was further analyzed by sequencing mpt64 and surrounding genes by using the primers listed in Table 2. Each PCR reaction contained 1.0 μl of DNA template, 12.5 μl of Type-it multiplex PCR Master mix, 2.5 μl of Q-solution, 0.5 μl of each primer (10 pmol/μl) and an appropriate amount of molecular grade water for a total reaction volume of 25 μl. The thermal profile was as follows: (i) 95°C (5 min); (ii) 30 cycles of 95°C (0.5 min), 62°C (1.5 min), 72°C (1 min); and (iii) final extension at 60°C (10 min). The amplified product was analyzed by 3% agarose gel electrophoresis and was purified using Mag Extractor (TOYOBO, Japan). The purified DNA products were subjected to direct sequencing using an ABI 377 automatic sequencer (Applied Biosystems, USA) and BigDye Terminator Cycle Sequencing v 3.1 (Applied Biosystems, USA), according to the manufacturer’s instructions. DNA sequences of mpt64 from each isolate were compared with M. tuberculosis H37Rv by using Genetyx-win ver. 5.2 (Genetyx Co., Japan).

                    Results

                    Each of the three kits (Capilia TB-Neo, SD MPT64, and TBc ID) was tested using the 99 reference strains. Capilia TB-Neo correctly produced positive results for four MTC (M. tuberculosis, M. africanum, M. bovis, and M. microti) and negative results for 92 NTM and 3 non-mycobacterial species (other genera) with acid-fastness, while SD MPT64 and TBc ID generated several false positives (Table 1). The sensitivity and specificity of Capilia TB-Neo to reference strains were 100%.

                    Of the 500 MTC clinical isolates tested, 497 were identified as MTC by Capilia TB-Neo. The other 3 isolates that tested negative by using Capilia TB-Neo also tested negative by using SD MPT64 and TBc ID. All three kits produced negative results for all 90 NTM clinical isolates examined. Thus, The sensitivity and specificity of Capilia TB-Neo to the clinical isolates were 99.4% and 100%, respectively.

                    The multiplex PCR system identified 492 M. tuberculosis isolates out of 500. Five isolates, which were cfp32-, RD9-, RD4-, RD7-, and MiD3-positive, but RD12-negative, were initially identified as M. canettii. However, colonies of these isolates showed a consistent rough surface on solid medium, and subsequent sequencing of hsp65 indicated that the isolates had the genotype of M. tuberculosis sensu stricto (data not shown). These isolates were collected from different areas of Japan. Consequently, 497 isolates were identified as M. tuberculosis. The remaining 3 isolates were deficient in RD1, RD4, RD7, RD9, and RD12, and therefore were identified as M. bovis BCG. Two of these isolates were confirmed as M. bovis BCG Tokyo based on the unique size of RD16, and the third isolate had the same RD pattern as BCG Connaught and BCG Montreal, as for RD2, RD14, RD15, RD16 and SenX3-RegX3 (Figure 1). Among the 3 MTC isolates that tested negative by Capilia TB-Neo, 2 isolates were M. tuberculosis and the other was M. bovis BCG Connaught or BCG Montreal (Table 3).
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2334-14-54/MediaObjects/12879_2013_3000_Fig1_HTML.jpg
                    Figure 1

                    Multiplex PCR analysis of Mycobacterium bovis BCG sub-strains and clinical isolates. 1: BCG Pasteur (ATCC35734), 2: BCG Glaxo (ATCC35741), 3: BCG Copenhagen (ATCC27290), 4: BCG Russian (ATCC35740), 5: BCG Montreal (ATCC35735), 6: BCG Connaught (ATCC35745), 7: BCG Danish, 8: BCG Tokyo, 9: Sample 421, 10: Sample 467, 11: Sample 475, M: Size marker.

                    Table 3

                    Results of PCR detection and Capilia TB-Neo of MTC with clinical isolates

                    Species interpretation (Number of isolates)

                    Banding pattern

                    Capilia TB-Neo

                    %

                     

                    cfp32

                    RD9

                    RD12

                    RD4

                    RD7

                    MiD3

                    RD1

                      

                    M. tuberculosis (490)

                    +

                    +

                    +

                    NT

                    NT

                    NT

                    NT

                    +

                    98.0

                    M. tuberculosis (2)

                    +

                    +

                    +

                    NT

                    NT

                    NT

                    NT

                    -

                    0.4

                    "M. canettii" (5)a

                    +

                    +

                    -

                    +

                    +

                    +

                    +

                    +

                    1.0

                    M. bovis BCG Tokyo (2)b

                    +

                    -

                    -

                    -

                    -

                    +

                    -

                    +

                    0.4

                    M. bovis BCG Connaught (1)c

                    +

                    -

                    -

                    -

                    -

                    +

                    -

                    -

                    0.2

                    aConfirmed to be M. tuberculosis by hsp65  sequencing and morphology, bConfirmed by contracted RD16, cConfirmed by absence of RD2 and RD15, and contracted SenX3-RegX3, NT: Not tested.

                    Mutations in the mpt64 gene were detected by sequencing two M. tuberculosis isolates with negative results by Capilia TB-Neo. One isolate had a deletion of 63 bp from nucleotides 196 to 258 (amino acids position 43 to 63), and the other had a deletion of 3,659 bp from nucleotide 874 in Rv1977 to nucleotide 905 in Rv1981c, which included the whole mpt64 gene.

                    Discussion

                    In many industrialized countries, the ability to rapidly distinguish between MTC and NTM is critical in clinical practice. Indeed, the anti-tuberculosis drug resistance survey in Japan revealed that 19.3% of all clinical mycobacterial isolates are NTM [18], underscoring the importance of rapid and accurate detection of MTC from acid-fast bacillus-positive culture. The immunochromatographic assay kit for the identification of MTC is now widely used in many countries. Capilia TB-Neo is the improved version of Capilia TB, and has been subjected to few clinical evaluations. Here, we report good overall performance of the kit but with several limitations.

                    In this study, the sensitivity of Capilia TB-Neo was 99.4% to clinical MTC isolates or 99.6% excluding M. bovis BCG, while the specificity of the kit tested to clinical NTM isolates was 100%. However, the isolation of BCG could present a practical problem. The M. bovis BCG Tokyo strain is sporadically isolated in Japan as a complex of vaccination or bladder cancer therapy, and is identified as MTC with the kit [19]. Some BCG strains such as Connaught, Pasteur, and Tice lack RD2 including the mpt64 gene, but RD2 is conserved in others such as Tokyo, Moreau, and Russia [16]. This issue should be properly addressed to avoid confusion. Although it is difficult to discriminate BCG Tokyo from MTC with mpt64/mpb64, their differentiation would be an important advance in the development of a future TLC product. The weak false-positive reaction to M. marinum that was reported using Capilia TB [12] was not observed in this study, and resulted in better specificity. The minimum detection concentration of M. tuberculosis for Capilia TB-Neo was 105 CFU/ml (data not shown), which was one-tenth than that for the previous kit. There was a report that Cpilia TB-Neo was higher sensitivity than Capilia TB [20]. In summary, the overall performance of Capilia TB-Neo was better than Capilia TB in both sensitivity and specificity.

                    SD MPT64 and TBc ID were also tested with reference strains. Both SD MPT64 and TBc ID showed false-positive results against several NTM strains in this study. Kodama et al. [12] reported that no M. marinum strains grown on 2% Ogawa medium tested positive by using the Capilia TB, while all strains grown on 3 kinds of liquid medium, MGIT (Becton Dickinson, Japan), KRD medium (Japan BCG Laboratory, Japan) and Myco Acid (Kyokuto Pharmaceutical Industrial Co. Ltd., Japan), eventually displayed a positive reaction that intensified with time. Kodama et al. speculated that nonspecific antigen which could make complex with anti-MPB64 antibody may be produced in liquid mediums, but not on solid medium. Considering the effect of liquid culture, the original bacterial suspensions giving false-positive results, that were prepared from liquid and solid culture, were then re-tested before and after 10-fold dilution. Interestingly, none of these diluted strains tested positive in these kits, but bacterial concentrations were high enough for positive results in case of MTC. These results implied that a high concentration of bacterial antigens could induce non-specific reactions in SD MPT64 and TBc ID. The manufacturer’s instructions for the TBc ID indicate that this kit may be used up to 10 days after a positive MGIT alarm. This non-specific reaction should be properly addressed in clinical practice, and the users should perform morphological characterization with a microscope to identify cord formation.

                    Several mutations in the mpt64 gene produce a negative test result for M. tuberculosis isolates in the TLC assay using anti-MPB64 monoclonal antibodies. To date, these include a 63-bp deletion from nucleotide 196, a 1-bp deletion from nucleotide 266, a point mutation at position 388 or 402, IS6110 insertion mutation at position 177 or 501, a 176-bp deletion from nucleotide 512, and a 1-bp insertion at position 287 [10, 13, 21]. In our study, 2 M. tuberculosis isolates gave false-negative results by using the Capilia TB-Neo, SD MPT64, and TBc ID. One isolate had a deletion of 63 bp from nucleotide 196 in the mpt64 gene as reported previously, and the other isolate possessed a 3,659-bp deletion from nucleotide 874 in Rv1977 to 905 in Rv1981c, including the whole mpt64 gene. To the best of our knowledge, this is the first report of a large deletion in mpt64. A transposon site hybridization (TraSH) study [22] indicated that mpt64 is not essential for infection or in vitro growth of M. tuberculosis. This large deletion mutant supported the finding.

                    In summary, the TLC assay detecting MPB64 or MPT64 can be applied to specimens prepared from liquid and solid culture. It does not need special reagents, instruments, or complex techniques. Capilia TB-Neo tested in this study showed excellent sensitivity with perfect specificity.

                    Conclusions

                    Capilia TB-Neo showed high sensitivity and specificity with clinical mycobacterial isolates, and 100% specificity to reference strains. However, 2 M. tuberculosis isolates were tested negative by Capilia TB-Neo because of mutations in the mpt64 gene, and positive to certain BCG sub-strain. This study, therefore, serves to emphasize the importance of careful use of the kit and the complementary techniques such as morphological identification.

                    Declarations

                    Acknowledgements

                    We thank TAUNS Co, Ltd (Izunokuni, Japan) for providing the Capilia TB-Neo, SD MPT64, and TBc ID.

                    Authors’ Affiliations

                    (1)
                    Department of Mycobacterium Reference and Research, Research Institute of Tuberculosis, Japan Anti-Tuberculosis Association
                    (2)
                    Department of Basic Mycobacteriosis, Nagasaki University Graduate School of Biomedical Sciences
                    (3)
                    Miroku Medical Laboratory Company Limited

                    References

                    1. Public Health Mycobacteriology: A guide for the level III laboratory. In Identification Test Techniques: Department of Health and Human Services. Atran: Public Health Service. CDC; 1985.
                    2. Rastogi N, Goh KS, David HL: Selective inhibition of the Mycobacterium tuberculosis complex by p -nitro-a-acetylamino-b-hydroxypropiophenone (NAP) and p -nitrobenzoic acid (PNB) used in 7H11 agar medium. Res Microbiol 1989, 140:419–423.PubMedView Article
                    3. Goto M, Oka S, Okuzumi K, Kimura S, Shimada K: Evaluation of acridinium ester-labeled DNA probes for identification of Mycobacterium tuberculosis and Mycobacterium avium-Mycobacterium intracellulare complex in culture. J Clin Microbiol 1991, 29:2473–2476.PubMed CentralPubMed
                    4. Ioannidis P, Papaventsis D, Karabela S, Nikolaou S, Panagi M, Raftopoulou E, Konstantinidou E, Marinou I, Kanavaki S: Cepheid GeneXpert MTB/RIF Assay for Mycobacterium tuberculosis detection and rifampin resistance identification in patients with substantial clinical indications of tuberculosis and smear-negative microscopy results. J Clin Microbiol 2011, 49:3068–3070.PubMed CentralPubMedView Article
                    5. Mitarai S, Okumura M, Toyota E, Yoshiyama T, Aono A, Sejimo A, Azuma Y, Sugahara K, Nagasawa T, Nagayama N, Yamane A, Yano R, Kokuto H, Morimoto K, Ueyama M, Kubota M, Yi R, Ogata H, Kudoh S, Mori T: Evaluation of a simple loop-mediated isothermal amplification test kit for the diagnosis of tuberculosis. Int J Tuberc Lung Dis 2011, 15:1211–1217.PubMedView Article
                    6. Richter E, Rüsch-Gerdes S, Hillemann D: Evaluation of the genotype Mycobacterium assay for identification of Mycobacterial species from cultures. J Clin Microbiol 2006, 44:1769–1775.PubMed CentralPubMedView Article
                    7. Springer B, Stockman L, Teschner KD, Roberts G, Bottger EC: Two-laboratory collaborative study on identification of Mycobacteria: molecular versus phenotypic methods. J Clin Microbiol 1996, 34:296–303.PubMed CentralPubMed
                    8. Standardized Method for HPLC Identification of Mycobacteria: Department of Health and Human Services. Atranta: Public Health Service CDC; 1996.
                    9. Abe C, Hirano K, Tomiyama T: Simple and rapid identification of Mycobacterium tuberculosis complex by immunochromatographic assay using anti-MPB64 monoclonal antibodies. J Clin Microbiol 1999, 37:3693–3697.PubMed CentralPubMed
                    10. Hillemann D, Rüsch-Gerdes S, Richter E: Application of the Capilia TB assay for culture confirmation of Mycobacterium tuberculosis complex isolates. Int J Tuberc Lung Dis 2005, 9:1409–1411.PubMed
                    11. Muyoyeta M, de Haas PE, Mueller DH, van Helden PD, Mwenge L, Schaap A, Kruger C, Gey van Pittius NC, Lawrence K, Beyers N, Godfrey-Faussett P, Ayles H: Evaluation of the Capilia TB assay for culture confirmation of Mycobacterium tuberculosis infections in Zambia and South Africa. J Clin Microbiol 2010, 48:3773–3775.PubMed CentralPubMedView Article
                    12. Kodama A, Saito H: Evaluation of CapiliaTB for identification of Mycobacterium tuberculosis complex, with special reference to the culture medium. Jpn Society Clin Microbiol (in Japanese) 2007, 17:109–118.
                    13. Hirano K, Aono A, Takahashi M, Abe C: Mutations including IS 6110 insertion in the gene encoding the MPB64 protein of Capilia TB negative Mycobacterium tuberculosis isolates. J Clin Microbiol 2004, 42:390–392.PubMed CentralPubMedView Article
                    14. Nakajima C, Rahim Z, Fukushima Y, Sugawara I, Van der Zanden AGM, Tamaru A, Suzuki Y: Identification of Mycobacterium tuberculosis clinical isolates in Bangladesh by a species distinguishable multiplex PCR. BMC Infect Dis 2010, 10:118.PubMed CentralPubMedView Article
                    15. Huard RC, Fabre M, de Haas P, Lazzarini LC, van Soolingen D, Cousins D, Ho JL: Novel genetic polymorphisms that further delineate the phylogeny of the Mycobacterium tuberculosis complex. J Bacteriology 2006, 188:4271–4287.View Article
                    16. Bedwell J, Kario SK, Behr MA, Bygraves JA: Identification of substrains of BCG vaccine using multiplex PCR. Vaccine 2001, 19:2146–2151.PubMedView Article
                    17. Seki M, Sato A, Honda I, Yamazaki T, Yano I, Koyama A, Toida I: Modified multiplex PCR for identification of Bacillus Calmette-Guerin substrain Tokyo among clinical isolates. Vaccine 2005, 23:3099–3102.PubMedView Article
                    18. Tuberculosis Research Committee (Ryoken): Drug-resistant Mycobacterium tuberculosis in Japan: a nationwide survey, 2002. Int J Tuberc Lung Dis 2007, 11:1129–1135.
                    19. Morokuma Y, Uchida Y, Karashima T, Fujise M, Imamura S, Kayamori Y, Kang DC: Identification of Mycobacterium tuberculosis Complex Strains in Kyushu University Hospital. J J Clin Microbiol (in Japanese) 2008, 18:177–182.
                    20. Muyoyeta M, Mwanza WC, Kasese N, Cheeba-Lengwe M, Moyo M, Kaluba-Milimo D, Ayles H: Sensitivity, specificity, and reproducibility of the Capilia TB-Neo assay. J Clin Microbiol 2013, 51:4237–4239.PubMedView Article
                    21. Yu MC, Chen HY, Wu MH, Huang WL, Kuo YM, Yu FL, Jou R: Evaluation of the rapid MGIT TBc identification test for culture confirmation of Mycobacterium tuberculosis complex strain detection. J Clin Microbiol 2011, 49:802–807.PubMed CentralPubMedView Article
                    22. Sassetti CM, Boyd DH, Rubin EJ: Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol 2003, 48:77–84.PubMedView Article
                    23. Pre-publication history

                      1. The pre-publication history for this paper can be accessed here: http://​www.​biomedcentral.​com/​1471-2334/​14/​54/​prepub

                    Copyright

                    © Chikamatsu et al.; licensee BioMed Central Ltd. 2014

                    This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.