Skip to main content
Download PDF

The epidemiological and infectious characteristics of novel types of Coxiella burnetii co-infected with Coxiella-like microorganisms from Xuyi County, Jiangsu province, China

BMC Infectious Diseases volume 24, Article number: 1041 (2024) Cite this article

Abstract

Coxiella burnetii (C. burnetii) is the causative agent of Q fever, a type of zoonoses withwidespread distribution. In 2019, a case of Q fever was diagnosed by metagenomic next-generation sequencing (mNGS) method in Xuyi County (Jiangsu province, China). The seroprevalence of previous fever patients and the molecular epidemiology of Coxiella in wild hedgehogs and harbouring ticks around the confirmed patient were detected to reveal the genetic characteristics and pathogenicity of the Coxiella strains. Four of the 90 serum samples (4.44%) were positive for specific C. burnetii IgM antibody, suggesting that local humans are at risk of Q fever. The positive rates of C. burnetii in hedgehogs and ticks were 21.9% (7/32) and 70.5% (122/173), respectively. At least 3 strains of Coxiella were found prevalent in the investigated area, including one new genotype of pathogenic C. burnetii (XYHT29) and two non-pathogenic Coxiella-like organisms (XYHT19 and XYHT3). XYHT29 carried by ticks and wild hedgehogs successfully infected mice, imposing a potential threat to local humans. XYHT19, a novel Coxiella-like microorganism, was first discovered in the world to co-infect with C. burnetii in Haemaphysalis flava. The study provided significant epidemic information that could be used for prevention and control strategies against Q fever for local public health departments and medical institutions.

Peer Review reports

Introduction

Coxiella burnetii (C. burnetii), an intracellular Gram-negative bacterium, may cause serious diseases from chronic or acute Q fever, such as endocarditis, chronic hepatitis, and it may even lead to death. Tick bites may cause damage to the blood vessels and skin of animals, resulting in the transmission of C. burnetii among different species [1, 2]. Infection of C. burnetii has been reported in many animal species, with the principal reservoirs as small ruminants such as sheep, goats, and cattle [3]. Exposure or infection by C. burnetii has been reported in over 100 wild mammal species including rodents, deer, foxes, hedgehogs, etc [4]. However, the ecology of C. burnetii in wildlife and the potential roles of those wildlife in the transmission of C. burnetii are still poorly understood. Some wild animals, such as rodents and hedgehogs, with high reservoir potential and a high rate of interaction with livestock and humans, may be sources of C. burnetii for both livestock and human infection [5]. C. burnetii is a pathogen detected in various species throughout the animal kingdom [6, 7], but ruminants (sheep, goats, and cattle) are considered the main reservoir of the bacterium and can exhibit high prevalence of infection [8]. A recent study in China reported hedgehogs and their attached ticks could both serve as hosts and vectors of C. burnetii [9, 10].

In infected animals, C. burnetii sheds into the environment through milk, feces, urine, and especially in reproductive process [11,12,13]. The strong resistance of C. burnetii in the environment, its ability to spread through the air, and its high pathogenicity may lead to infection with only a small amount of pathogen exposure [14].

Q fever has been prevalent worldwide since it was first reported in Australia in 1937 [2]. From 2007 to 2010, a large-scale outbreak of Q fever occurred in the Netherlands, which caused about 4000 human cases [5, 15]. In 2020, a case of Q fever was reported in Australia. A 41-year-old man was admitted to a hospital with symptoms of persistent fever, sweating, headache, myalgia, and arthralgia. An engorged tick was found between his sheets after admission. Using laboratory test, he was diagnosed with acute Q fever [16]. Q fever has also been extensively distributed in China. Q fever outbreaks were reported in a few provinces of China, including Inner Mongolia, Sichuan, Xinjiang, Yunnan, and Tibet [17,18,19]. Antibodies to Q fever were detected in human or animal sera in 14 provinces from 1989 to 2015 [20]. Recently, an imperceptible epidemic of Q fever was identified in Zhuhai (China), which might originate from a slaughterhouse in the modern city [21].

C. burnetii is highly virulent, and it may cause vertebrate infection through inhalation of some bacteria in the respiratory tract. Symbiotes may mainly exist in ticks, which are never isolated from vertebrates. As well as pathogenic C. burnettii, a variety of Coxiella-like endosymbionts have been identified [1, 22], these mainly exist in ticks, and have never been isolated from vertebrates. The size of the C. burnetii genome is about 2 Mb [23]. Through the whole genome analysis of the symbionts, no virulent genes and proteins were found in the symbionts, and the genes mainly encoded vitamins and related cofactors, indicating that the symbionts mainly provided vitamins for the host. Ticks and symbiotes maintain a symbiotic relationship, and symbiotes provide essential vitamins and nutrients for the growth and development of ticks [24,25,26,27]. This interaction is typical in matrilineal genetic symbiotes and plays an important role in arthropod biology [28, 29]. It was speculated that C. burnetii could be evolved from Coxiella-like symbionts. There is a great genetic similarity between C. burnetii and symbionts, and identification of C. burnetii and Coxiella-like symbionts in the same tick supports this hypothesis [1].

In recent years, multiple Q fever cases who had history of contact with animals have been reported [30]. Some unexplained persistent fevers were not diagnosed until introduction of metagenomic next-generation sequencing (mNGS) [19, 31]. However, several cases have remained undetected due to the lack of knowledge about the prevalent types of C. burnetii and limited testing methods in the epidemic areas. To achieve fundamental information of Q fever and its causative agent in the area, and to guide the development of preventive and control strategies, the epidemic type, pathogenicity, infection status of C. burnetii in local population, and the potential transmission risk of local wild animals and vectors were detected and evaluated.

Materials and methods

Case and the diagnosis using mNGS

A 67-year-old woman from Xuyi, Jiangsu province, presented with acute fever (38–39.2 °C), unprovoked chills, pain in the right upper abdomen and back, and frequent and urgent urination. To explore the etiology of fever, the patient’s whole blood was collected for mNGS. Briefly, total DNA was extracted from 200 µL of the whole blood using a QIAamp DNA Mini kit (Qiagen, Germany), and its concentration was determined by Qubit 4.0 fluorometer before the library construction. The library was then constructed using MGISEQ-2000RS FCL SE100 library kit (MGI, China) according to the instructions of the manufacturer. The cyclized products were loaded onto a sequencing chip, and the library was sequenced on the MGISEQ-2000 platform (MGI) to generate 100 bp single-end reads. The raw sequencing data in FASTQ format were obtained. Low-quality reads were removed by using fastp (v0.22.0). The cleaned reads were then aligned to the human reference genome (version 38) via BWA (v0.7.17) to eliminate the host background. The remaining reads were aligned to the NCBI nucleotide database (NT database) to obtain sequences of potential pathogens with BLASTN (v2.11.0).

Sample sites and sample collection

From May 2019 to October 2021, 32 hedgehogs were collected from villages near Tieshan Temple (E 118°29’6”, N 32°43’55”) in Xuyi County, where the Q fever patient worked and lived. Totally, 173 adult ticks were isolated from the skin. All of hedgehogs died from roadkill, domestic or stray dogs, and they were obtained within 48 h after death. Ticks from these wild animals were also collected. Human blood samples (n = 90) were collected from patients with fever of unknown origin who were admitted to Xuyi Traditional Chinese Medicine Hospital under ethics approval and informed consent. Serum samples were transported to the laboratory using a 4 °C biological sample transfer box, and tick and hedgehog samples were transported to the laboratory on dry ice. Hedgehogs were dissected to collect hearts, livers, spleens, lungs, kidneys, brains, and intestines, and the specimens were stored at -80 °C [9]. In addition, the species of hedgehogs and ticks were identified through morphological and molecular tests.

Typing of C. burnetii

DNA purification and polymerase chain reaction (PCR) amplification

Tick samples were washed twice with 75% ethanol, rinsed with sterile phosphate-buffered saline (PBS), and individually homogenized in 1 mL of PBS using glass homogenizers. For the hedgehog tissue samples, 1 g of each sample mixed with 1 mL of PBS was homogenized thoroughly. Total DNA from 200 µL of each tick homogenate, serum of each febrile patient, and 20 µL of each hedgehog organ sample was extracted using a commercial MagaBio plus DNA purification kit (Bioer, Hangzhou, China) according to the manufacturer’s instructions. The purified DNA was subsequently stored at -20 °C.

Molecular identification of tick species, serum from febrile patients, and hedgehogs was performed by amplification of the corresponding sequences of the mitochondrial 16 S rRNA genes as previously described [32]. To identify the species of each hedgehog, a partial sequence of the mitochondrial 16 S rRNA gene (approximately 201–211 nucleotides (nt) in length) was PCR-amplified using genomic DNA from hedgehog muscle tissues [33]. Briefly, PCR amplification was carried out using TaKaRa Ex Taq (Takara, Beijing, China) with 1 µL of each primer (10 nM) and 1 µL of template in each reaction. All PCR reactions were conducted under the following conditions: 35 cycles of denaturation for 30 s at 95 °C, annealing for 30 s at the temperature of Tm, and extension for 60 s per Kb at 72 °C. PCR products were analysed with 1.5% agarose gel electrophoresis and detected using Gel Stain (TransGen, Beijing, China) under ultraviolet light. The PCR products were sequenced by Sangon Co., Ltd. (Shanghai, China).

Multispacer sequence typing (MST) of pathogens

To identify the potential pathogens in the Coxiella-positive samples, MST was conducted as previously described [9, 34, 35]. Briefly, 10 gene spacers (COX2, COX5, COX18, COX20, COX22, COX37, COX51, COX56, COX57, and COX61) were amplified using PCR with their corresponding primers (Table S1). After gel electrophoresis analysis, the positive PCR products were sequenced by Sangon Co., Ltd. (Shanghai, China). The obtained sequences were compared with the existed sequences in the database online (http://ifr48.timone.univ-mrs.fr/mst/coxiella_burnetii/groups.html) to identify the potential genotypes.

Multilocus sequence typing (MLST) and phylogenetic analysis

The other four genes, including 23 S rRNA, groEL, rpoB, and dnaK in the Coxiella-positive samples were amplified by nested PCR and sequenced as previously described [1, 36]. The primers used were indicated in Table S1. Moreover, 16 S rRNA, 23 S rRNA, groEL, rpoB, and dnaK gene sequences were concatenated (XYHT19 GenBank: ON390844, OP236726, ON455113, ON455114, ON455112; XYHT29 GenBank: ON387651, OP236736, ON455116, ON455117, ON455115). Based on the concatenated sequences, the sequence alignment and phylogenetic analysis were carried out. Phylogenetic analysis was conducted using MEGA X, phylogenetic trees were constructed using maximum likelihood method, and nucleotide sequences and bootstrap values were calculated with 1000 repeats. Only bootstrap values ≥ 60% were displayed in the phylogenetic trees.

Pathogenicity analysis

Infectivity analysis by infecting mice

The infectivity of the identified types of C. burnetii except for Coxiella-like organism was evaluated by infecting BALB/c mice. Briefly, 200 µL of the supernatant of abrasive solution Coxiella-positive ticks (single or dual types infected) was injected intraperitoneally into BALB/c mice (3-day-old), and 4 mice were inoculated with each sample. PBS was used as blank control [37]. After 2 weeks of inoculation, the mice were sacrificed and their organs including heart, liver, spleen, kidney, and brain were collected. Total DNA was extracted from 10 mg of each spleen and 30 mg of each other organ using a QIAamp DNA mini Kit (Qiagen, Germany). C. burnetii pathogen in each DNA sample was detected with nested PCR targeting 16 S rRNA as mentioned above and the positive products were confirmed by Sanger sequencing.

Fluorescence in situ hybridization (FISH)

The livers of the positive mice were analysed by FISH. The murine liver tissue was washed, placed into the fixed fluid (DEPC), dehydrated, embedded, sliced, and baked for 2 h. The sections were dewaxed and digested with protease K at 37 ℃ for 10 min, thrice washed with PBS, incubated with pre-hybridization solution for 1 h at 37 ℃, and incubated at 37 ℃ overnight with the probe hybridization solution (CB-189: 5‘-CCGAAGATCCCCCGCTTTGC-3’) [38]. After washing, the sections were incubated with 4′,6-diamidino-2-phenylindole (DAPI) for 8 min in the dark, and were then mounted. DAPI glows blue by excitation at 330–380 nm and emission at 420 nm, and CY3 glows red by excitation at 510–560 nm and emission at 590 nm.

Detection of antibodies in patients’ sera

IgM and IgG antibodies in sera from 90 febrile patients were detected using an Anti-Coxiella burnetii (Q-Fever) Phase 2 IgM ELISA kit (Abcam, Cambridge, UK), and Anti-Coxiella burnetii(Q-Fever) Phase 2 IgG ELISA Kit(Abcam, Cambridge, UK)according to the manufacturer’s instructions. All the sera were diluted (1:100). The absorbance of the specimens at 450 nm (optical density (OD), 450) was measured using a microplate reader. The background-subtracted mean absorbance of all the samples was calculated and 10% above average was calculated as a cut-off value. Samples were considered to be positive if the absorbance value was greater than the cut-off value.

Results

Potential Q fever case

A laboratory test of the potential Q fever case was conducted at admission, with white blood cell count 13.72 × 109 /L↑, neutrophil count 6.56 × 109 /L↑, C-reactive protein 88.8 mg/L↑, potassium 3.2 mg/L↓, sodium 131 mmol/L↓, albumin 34.4 g/L↓, aspartic aminotransferase 53 U/L, lactate dehydrogenase 365 U/L↑, Lipase 303 U/L↑, and interleukin-6 169.10 ng/L↑. Combined with the exposure history, a diagnosis of potential rickettsial infection was preliminary confirmed and mNGS was done for further confirmation.

The results of the mNGS of the patient’s whole blood showed that the total number of sequences was 25,227,956, and 1,958 sequences were left after the removal of the human genomic sequences. Among the detected sequences, there was a C. burnetii sequence (TTAGGGAATACCGATCCGGTAGCCGTTTCTTCACTATCGGAATGAAGAGAAAAGCCGCTAAAATTCAAGAAGCACT), with the size of 76 bp. This sequence was subsequently aligned in GenBank using the BLAST search engine (https://blast.ncbi.nlm.nih.gov/Blast.cgi). This sequence matched a total of 27 hypothetical protein genes of C. burnetii with the homology of 100%. Other sequences did not match any pathogens, including bacteria, fungi, viruses and parasites. Combined with the patient’s clinical symptoms, C. burnetii infection was confirmed.

Classification of hedgehogs, ticks, and C. burnetii

Hedgehogs were identified as Erinaceus amurensis by the highest nucleotide similarity (97%) between the amplified partial mitochondrial 16 S rRNA gene sequences (GenBank: ON016529) and Er. Amurensis (GenBank: KX964606) in the GenBank database. The species of ticks and C. burnetii were detected by 16 S rRNA gene amplification as shown in Figure S3. There were 164 Haemaphysalis flava and 9 Haemaphysalis longicornis in hedgehog ticks as shown in Table 1.

Moreover, 16 S rRNA gene sequences were amplified in hedgehog-attached ticks and hedgehog tissues. Furthermore, 3 variant 16 S rRNA sequences of Coxiella were identified (XYHT3, XYHT19, and XYHT29), indicating the presence of three types of this pathogen (Fig. 1A). The 16 S rRNA genes of XYHT29 (GenBank: ON387651.1), XYHT19 (GenBank: ON390844.1) and XYHT3 (GenBank: ON384646.1) showed 100% homology with strain RSA439 (GenBank: CP040059.1), Coxiella sp. (in: Bacteria) (GenBank: MG906671.1), and Coxiella-like organism (GenBank: MG682448.1), respectively.

Positive rates of hedgehog-attached ticks and hedgehogs

Through 16 S rRNA gene identification, 164 H. flava and 9 H. longicornis were identified. The infection rate of Coxiella was 70.52% (122/173). XYHT3 strain was detected only in 7 H. longicornis, XYHT29 strain was identified in 101 H. flava, and XYHT19 strain was detected in 14 H. flava (Table 1). The original sequencing data of each sample were analysed using Snapgene software, and overlapping peaks were found in 3 ticks (Fig. 2), indicating co-infection with XYHT19 and XYHT29 in these samples.

Fig. 1
figure 1

Sequencing results of co-infection with XYHT19 and XYHT29. Three samples showed an overlap in the sequencing analysis performed by Snapgene software. Three ticks were found to be co-infected with XYHT19 and XYHT29. The overlapping peaks were marked by arrows

Full size image

Besides, XYHT29 strains were detected in 7 of 32 hedgehogs. It is noteworthy that the positive rates of different organs in hedgehogs varied (Table 2), with the highest positive rates of spleen and lung.

Table 1 Tick species and Coxiella infection
Full size table
Table 2 Distribution of XYHT29 in different organs of the infected hedgehogs
Full size table

MST of C. burnetii

For MST, 10 gene spacers of the 3 identified types or strains were amplified and sequenced. However, all the spacer regions of HYHT29, rather than HYHT3 and HYHT19, were completely amplified and obtained. The results of MST classification showed that HYHT29 was a new genotype (Table 3), and phylogenetic analysis revealed that it was in the same branch with MST71 and MST72 genotypes (Fig. 3).

Fig. 2
figure 2

Maximum likelihood phylogenetic tree of C. burnetiigenotypes identified by MST. Bootstrap values were calculated with 1000 replicates. Bootstrap values ≥ 60% were shown at branch nodes. The novel genotypes detected in this study were marked with a black triangle

Full size image
Table 3 Multispacer sequence types found in Chinese hedgehogs
Full size table

MLST and phylogenetic analysis

MLST was used to identify strains using 16 S rRNA, 23 S rRNA, groEL, rpoB, and dnaK genes. All the five genes were amplified and sequenced in HYHT19 and HYHT29, while dnaK gene in HYHT3 was not successfully amplified. According to the phylogenetic analysis using the concatenated sequence, XYHT29 branched independently and it was in the same cluster as C. burnetii. A separate branch of XYHT19 intermediated between C. burnetii and Coxiella-like organisms (Fig. 4). The results indicated that XYHT29 was a new C. burnetii strain and XYHT19 could be a new Coxiella species.

Fig. 3
figure 3

Phylogenetic tree of 16S rRNA, 23 S rRNA, groEL, rpoB, anddnaKgenes. Bootstrap values were calculated with 1 000 replicates. Bootstrap values ≥ 60% were shown at branch nodes. The novel genotypes detected in this study were marked with black triangles

Full size image

Pathogenicity analysis of XYHT29 and XYHT19

Mice were inoculated with the supernatant of abrasive solution of ticks carrying XYHT29, XYHT19, and both strains for 2 weeks. After inoculation with XYHT29 and both strains, the mice exhibited reduced activity and piloerection on the 5th day, abdominal arching and partially closed eyes on the 7th day, and these symptoms persisted until the 14th day. However, no such physiological state was observed in the mice inoculated with XYHT19. The existence of C. burnetii in various organs of the infected mice was detected using nested PCR. XYH19 was not detected in any organs of mice, while XYHT29 was detected in livers and spleens of mice inoculated with tick suspension harboring XYHT29 or both XYHT29 and XYHT19 (Fig. 1B).

Moreover, FISH was conducted for further confirmation of XYHT29 infection. As a result, C. burnetii was visually recognized in tissues of mice infected with ticks harboring XYHT29 or both XYHT29 and XYHT19, which was consistent with the nested PCR results (Fig. 5).

Fig. 4
figure 4

C. burnetii propagation pattern diagramA: Haemaphysalis flava and Haemaphysalis longicornis were collected from hedgehogs, in which XYHT3 was detected in Haemaphysalis longicornis, and XYHT19 and XYHT29 were detected in Haemaphysalis flava. B: BALB/C suckled mice were intraperitoneally inoculated with the tick grind suspension carrying XYHT19, XYHT29 and both, and the existence of either strain in each organ of mice was detected after 2 weeks

Full size image
Fig. 5
figure 5

Fluorescence in situ hybridization of mouse liver. Taking photos with positive fluorescence microscope. The nuclear staining by DAPI was blue under ultraviolet excitation, and the positive expression was red light by CY3. The images would correspond to the nuclei counter-stained with DAPI in blue (A), the red channel showing hybridization of oligonucleotide probes (B), and the merged signals (C). The arrows indicated the particles of the C. burnetiid. C. burnetii could be directly visualized in infected cells, mainly in the intracytoplasmic area

Full size image

Detection of specific antibodies against C. Burnetii and nucleic acid in febrile patients’ sera

Serum samples from 90 febrile patients with unknown origin were used to detect specific IgM and IgG antibodies. Four samples were positive for phase II IgM antibody, with a positive rate of 4.44% (4/90). However, no sera were positive for phase I or II IgG. Besides, no 16 S rRNA gene sequences of C. burnetii were amplified in serum samples of 90 patients.

Discussion

C. burnetii is an important tick-borne pathogen. Ticks are a reservoir host that can transmit C. burnetii to various vertebrates, such as cattle, hedgehogs, and sheep through bite and other means [39]. Hedgehogs, which typically live around humans, are often captured and used as raw materials in Chinese traditional medicine or as pets in China [9, 32]. In this context, special attention should be paid to C. burnetii and Q fever.In Xuyi County, there have been annual reports of villagers suffering from unexplained fever caused by tick bites in recent years. Due to the lack of diagnostic methods for Q fever in basic medical institutions, the disease is mainly neglected and underdiagnosed. In the present study, the patient’s the whole blood was analysed by mNGS, and a sequence of C. burnetii was identified. Combined with the clinical features, the laboratory test results, and the exposure history, C. burnetii infection was confirmed. However, only a short sequence was detected in mNGS, which may be due to the low levels of the bacteria in the blood and the degradation of the genome sequences. Also, gene sequences were not detected in the IgM-positive human sera may be due to the same reason.

In non-epidemic areas, the diagnosis of Q fever remains a challenge. Patients with acute fever of unknown etiology often face misdiagnosis and delays in diagnosis. mNGS has become an indispensable tool in clinical diagnostics in China due to its high-throughput pathogen identification capabilities. However, for C. burnetii detection, differences in sample types and disease progression may affect the detection rate. As a result, the number of detected sequences varies significantly across different studies. In a recent case report, a relatively high abundance of sequences (hundreds of reads) was detected in the biopsy of a mass that yielded pus via mNGS, while no pathogens were identified in the blood [40]. Another study using bronchoalveolar lavage for mNGS detection only detected 5 reads of C. burnetiid [41]. In addition, dozens of sequence reads of C. burnetii were detected in venous blood using mNGS in a case from Wuhan, China, leading to the confirmation of Q fever [42]. So, it is not unexpected that only one sequence was detected in this study. This underscores the importance of establishing testing standards for mNGS to effectively detect potentially infectious diseases.

In addition, the seroprevalence of Q fever, the potential origination of the pathogen, and the prevalent pathogenic strains or types of C. burnetii were investigated.

The seroprevalence study was conducted to confirm the potential prevalence of Q fever in this area. Specific IgM antibodies were screened in sera from patients with fever of unknown origin, resulting in the detection of four positive samples containing specific IgM, which supports the prevalence of Q fever in this region. However, in this retrospective seroprevalence analysis, convalescent sera were not collected, and the change in antibody titer between acute and convalescent sera was not tested. This could undermine the credibility of the results, and a broader study is still needed to further estimate the prevalence of Q fever in this area.

To explore the potential etiology of Q fever in Jiangsu province, the presence of C. burnetii in wild hedgehog and tick samples was detected. Three strains of Coxiella were identified by nucleic acid detection and phylogenetic analysis. XYHT3 and XYHT19 could only be detected in tick samples, and XYHT3 was considered as a Coxiella-like organism. MLST based on concatenated genes showed that XYHT19 formed a separate branch between C. burnetii and Coxiella-like organism, indicating a novel Coxiella species. Only the 16 S rRNA gene was matched with C. burnetii, and the other 4 genes (23 S rRNA, groEL, rpoB, and dnaK) were matched with Coxiella-like organism. Besides, XYHT29 was clustered with C. burnetii and branched separately, which was considered as a new type. MST based on 10 spacers confirmed that XYHT 29 was a novel genotype between MST71 and MST72.

In the present study, both XYHT19 and XYHT29 were used to infect mice, while only XYHT29 was detected in the organs of mice. The experiment was carried out for three times and the results did not change. In addition, only XYHT29, rather than XYHT19, was detected in hedgehog organs. Therefore, it was supposed that XYHT29, rather than XYHT19, could be a pathogenic strain, and XYHT19 was inferred as a new Coxiella-like organism, which could only be transmitted between ticks, rather than vertebrates. In addition, we aligned the amino acid sequences of GroEL, RpoB, and DnaK from strains XYHT19 and XYHT29 with those from the highly pathogenic strain NMI_RSA493 (GenBank: NZ_CP115461). The results indicated that the three proteins from strain NMI_RSA493 (GroEL: WP_005770500.1; RpoB: WP_010957447.1; DnaK: WP_005770882.1) shared identity rates of 92.93%, 85.28%, and 93.83% with those from strain XYHT19, respectively, while they shared 100%, 100%, and 99.50% identity rates with those from strain XYHT29. These alignment results confirmed that strain XYHT29 is more similar to the pathogenic strain than strain XYHT19.

Ticks can directly transmit pathogens by biting wildlife, livestock, and humans [43]. Human inhalation of pathogen aerosols formed from placental derivatives, faeces, blood, or the urine of infected animals, or ingestion of contaminated raw dairy products, can easily lead to infection or seroconversion [44,45,46]. Therefore, C. burnetii has imposed a great threat to people’s health. Importantly, further attention should be paid to the newly detected type of C. burnetii because it may be the main prevalent type in the investigated area.

It is noteworthy that both XYHT29 and XYHT19 were identified in the same tick. This is important because XYHT19 may be a new Coxiella-like organism. Coxiella-like organisms of ticks may act as obligate mutualistic symbionts required to support normal tick development [26, 47]. To our knowledge, no Coxiella-like organism has ever been isolated from vertebrates, and it has never been associated with clinical symptoms, which is consistent with strain XYHT19 in the present study. Moreover, it is the first time that the co-infection of Coxiella-like organism and C. burnetii in ticks is reported. As C. burnetii is an evolutionary transformation process from a maternally inherited tick endosymbiont to a vertebrate-specific virulent pathogen, the potential mutations of C. burnetii based on homologous recombination should be further assessed in the co-infection condition [28].

C. burnetii is an intracellular pathogen. However, it can produce spore-like small cell variants as extracellular forms that are able to survive in the environment for a long time and infect some animals [44, 48]. It is mainly transmitted through the respiratory tract and causes Q fever in humans. Acute Q fever is a self-limiting disease, while chronic Q fever may lead to chronic endocarditis and chronic hepatitis, seriously threatening humans’ health [49, 50]. Previous studies have shown that the positive rate of C. burnetii antibody in serum was relatively high in Xuyi County [20]. In the present study, IgM antibody against C. burnetii was detected in 4 of 90 febrile patients with unknown origin. However, IgG antibodies were not detected in the population, suggesting these people might not be exposed to the pathogen before or have been exposed for a long time. So, we suppose the detected IgM antibody may be a result of cross-reactivity of the antigens used in the kit or a recent exposure of the patients to the emergent pathogen. Also, the small population used in the present study may influence the actual background IgG-positive rate in the investigated aera. Nevertheless, the discovery of the novel pathogenic strain XYHT29 reminds us to be vigilant about this pathogen. In the assessed area, efficient diagnostic methods for Q fever are urgently needed and the prevalence of Q fever is worthy of investigation. According to the results of the mNGS, only one C. burnetii sequence was detected, which might be caused by the complicated sequencing background and the sharp decrease in the number of pathogens in the patient’s blood after treatment.

In addition, there are limitations in the present study. The presence of specific antibodies and the dynamics of antibody changes in the sera of potential Q fever cases were not assessed due to improper storage and collection of the samples. Proper sample handling and timely retention are crucial. Currently, we are collecting specimens from potential cases for further evaluation of the prevalence of Q fever in this area and to investigate evidence of strain XYHT29 infecting humans.

In summary, the results of the present study, which were performed in Xuyi County, demonstrate that the risk of Q fever in humans is noteworthy. At least 3 strains of Coxiella were found prevalent in the investigated area, including one new genotype of pathogenic C. burnetii XYHT29 and two non-pathogenic Coxiella-like organisms XYHT19 and XYHT3. XYHT29 could infect both hedgehogs and mice, and it was supposed to impose potential threat to local humans through transmission chains of both ticks and wild hedgehogs. XYHT19 was defined as a new Coxiella-like organism. Co-infection of Coxiella-like organisms with C. burnetii in H. flava was reported for the first time in the world. Urgent measures are needed to reduce infection rate and improve diagnostic methods. The study also provides valuable epidemic information that can be used for developing prevention and control strategies against Q fever for local public health departments and medical institutions.

Data availability

The data generated in this study were available in the main text and the supplementary materials. The datasets generated and/or analysed during the current study are available in the GenBank repository (16 S rRNA, 23 S rRNA, groEL, rpoB, and dnaK gene of XYHT19 GenBank: ON390844, OP236726, ON455113, ON455114, ON455112; 16 S rRNA, 23 S rRNA, groEL, rpoB, and dnaK gene of XYHT29 GenBank: ON387651, OP236736, ON455116, ON455117, ON455115).The source data files were available from njcdc@163.com upon reasonable request.

References

  1. Duron O, Noel V, McCoy KD, Bonazzi M, Sidi-Boumedine K, Morel O, Vavre F, Zenner L, Jourdain E, Durand P, et al. The recent evolution of a maternally-inherited endosymbiont of Ticks Led to the emergence of the Q Fever Pathogen, Coxiella burnetii. PLoS Pathog. 2015;11(5):e1004892.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Derrick EH. Q fever, a new fever entity: clinical features, diagnosis and laboratory investigation. Rev Infect Dis. 1983;5(4):790–800.

    Article  CAS  PubMed  Google Scholar 

  3. Vanderburg S, Rubach MP, Halliday JE, Cleaveland S, Reddy EA, Crump JA. Epidemiology of Coxiella burnetii infection in Africa: a OneHealth systematic review. PLoS Negl Trop Dis. 2014;8(4):e2787.

    Article  PubMed  PubMed Central  Google Scholar 

  4. González-Barrio D, Ruiz-Fons F. Coxiella burnetii in wild mammals: a systematic review. Transbound Emerg Dis, 66(2):662–71.

  5. Mangombi-Pambou J, Granjon L, Labarrere C, Kane M, Niang Y, Fournier PE, Delerce J, Fenollar F, Mediannikov O. New genotype of Coxiella burnetii causing epizootic Q fever outbreak in rodents, Northern Senegal. Emerg Infect Dis. 2023;29(5):1078–81.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Kalaitzakis E, Fancello T, Simons X, Chaligiannis I, Tomaiuolo S, Andreopoulou M, Petrone D, Papapostolou A, Giadinis ND, Panousis N et al. Coxiella burnetii shedding in milk and molecular typing of strains infecting dairy cows in Greece. Pathogens 2021, 10(3).

  7. Kersh GJ, Lambourn DM, Raverty SA, Fitzpatrick KA, Self JS, Akmajian AM, Jeffries SJ, Huggins J, Drew CP, Zaki SR, et al. Coxiella burnetii infection of marine mammals in the Pacific Northwest, 1997–2010. J Wildl Dis. 2012;48(1):201–6.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Agerholm JS. Coxiella burnetii associated reproductive disorders in domestic animals–a critical review. Acta Vet Scand. 2013;55(1):13.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Gong XQ, Xiao X, Liu JW, Han HJ, Qin XR, Lei SC, Yu XJ. Occurrence and genotyping of Coxiella burnetii in Hedgehogs in China. Vector Borne Zoonotic Dis. 2020;20(8):580–5.

    Article  PubMed  Google Scholar 

  10. Qi Y, Ai L, Zhu C, Ye F, Lv R, Wang J, Mao Y, Lu N, Tan W. Wild hedgehogs and their parasitic ticks coinfected with multiple Tick-Borne pathogens in Jiangsu Province, Eastern China. Microbiol Spectr. 2022;10(5):e0213822.

    Article  PubMed  Google Scholar 

  11. Di Domenico M, Curini V, De Massis F, Di Provvido A, Scacchia M, Camma C. Coxiella burnetii in central Italy: novel genotypes are circulating in cattle and goats. Vector Borne Zoonotic Dis. 2014;14(10):710–5.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Conan A, Becker A, Alava V, Chapwanya A, Carter J, Roman K, Avsaroglu H, Gallagher CA. Detection of Coxiella burnetii antibodies in sheep and cattle on a veterinary campus in St. Kitts: implications for one health in the Caribbean region. One Health. 2020;10:100163.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Rodolakis A, Berri M, Hechard C, Caudron C, Souriau A, Bodier CC, Blanchard B, Camuset P, Devillechaise P, Natorp JC, et al. Comparison of Coxiella burnetii shedding in milk of dairy bovine, caprine, and ovine herds. J Dairy Sci. 2007;90(12):5352–60.

    Article  CAS  PubMed  Google Scholar 

  14. Beslagic E, Hamzic S, Beslagic O, Zvizdic S. Public health problem of zoonoses with emphasis on Q fever. Ann N Y Acad Sci. 2006;1078:203–5.

    Article  CAS  PubMed  Google Scholar 

  15. Delsing CE, Kullberg BJ, Bleeker-Rovers CP. Q fever in the Netherlands from 2007 to 2010. Neth J Med. 2010;68(12):382–7.

    CAS  PubMed  Google Scholar 

  16. Graves SR, Gerrard J, Coghill S. Q fever following a tick bite. Aust J Gen Pract. 2020;49(12):823–5.

    Article  PubMed  Google Scholar 

  17. Cong W, Meng QF, Shan XF, Sun WW, Kang YH, Chen L, Wang WL, Qian AD. Coxiella burnetii (Q fever) infection in Farmed ruminants in three northeastern provinces and Inner Mongolia Autonomous Region, China. Vector Borne Zoonotic Dis. 2015;15(8):512–4.

    Article  PubMed  Google Scholar 

  18. Han X, Hsu J, Miao Q, Zhou BT, Fan HW, Xiong XL, Wen BH, Wu L, Yan XW, Fang Q, et al. Retrospective examination of Q fever endocarditis: an underdiagnosed disease in the Mainland of China. Chin Med J (Engl). 2017;130(1):64–70.

    Article  PubMed  Google Scholar 

  19. Li J, Li Y, Moumouni PFA, Lee SH, Galon EM, Tumwebaze MA, Yang H, Huercha, Liu M, Guo H, et al. First description of Coxiella burnetii and Rickettsia spp. infection and molecular detection of piroplasma co-infecting horses in Xinjiang Uygur Autonomous Region, China. Parasitol Int. 2020;76:102028.

    Article  CAS  PubMed  Google Scholar 

  20. El-Mahallawy HS, Lu G, Kelly P, Xu D, Li Y, Fan W, Wang C. Q fever in China: a systematic review, 1989–2013. Epidemiol Infect. 2015;143(4):673–81.

    Article  CAS  PubMed  Google Scholar 

  21. Huang M, Ma J, Jiao J, Li C, Chen L, Zhu Z, Ruan F, Xing L, Zheng X, Fu M, et al. The epidemic of Q fever in 2018 to 2019 in Zhuhai city of China determined by metagenomic next-generation sequencing. PLoS Negl Trop Dis. 2021;15(7):e0009520.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Shi M, Qin T, Liu Z, Feng H, Sun Y. Molecular detection of Candidatus Coxiella mudorwiae in Haemaphysalis concinna in China. Zoonoses 2022, 2(1).

  23. Seshadri R, Paulsen IT, Eisen JA, Read TD, Nelson KE, Nelson WC, Ward NL, Tettelin H, Davidsen TM, Beanan MJ, et al. Complete genome sequence of the Q-fever pathogen Coxiella burnetii. Proc Natl Acad Sci U S A. 2003;100(9):5455–60.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Lalzar I, Friedmann Y, Gottlieb Y. Tissue tropism and vertical transmission of Coxiella in Rhipicephalus sanguineus and Rhipicephalus turanicus ticks. Environ Microbiol. 2014;16(12):3657–68.

    Article  PubMed  Google Scholar 

  25. Machado-Ferreira E, Dietrich G, Hojgaard A, Levin M, Piesman J, Zeidner NS, Soares CA. Coxiella symbionts in the cayenne tick Amblyomma cajennense. Microb Ecol. 2011;62(1):134–42.

    Article  PubMed  Google Scholar 

  26. Smith TA, Driscoll T, Gillespie JJ, Raghavan R. A Coxiella-like endosymbiont is a potential vitamin source for the Lone Star tick. Genome Biol Evol. 2015;7(3):831–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Zhong J, Jasinskas A, Barbour AG. Antibiotic treatment of the tick vector Amblyomma americanum reduced reproductive fitness. PLoS ONE. 2007;2(5):e405.

    Article  PubMed  PubMed Central  Google Scholar 

  28. Moran NA, McCutcheon JP, Nakabachi A. Genomics and evolution of heritable bacterial symbionts. Annu Rev Genet. 2008;42:165–90.

    Article  CAS  PubMed  Google Scholar 

  29. Wernegreen JJ, Endosymbiosis. Curr Biol. 2012;22(14):R555–561.

    Article  CAS  PubMed  Google Scholar 

  30. Pinsky RL, Fishbein DB, Greene CR, Gensheimer KF. An outbreak of cat-associated Q fever in the United States. J Infect Dis. 1991;164(1):202–4.

    Article  CAS  PubMed  Google Scholar 

  31. Hemsley CM, O’Neill PA, Essex-Lopresti A, Norville IH, Atkins TP, Titball RW. Extensive genome analysis of Coxiella burnetii reveals limited evolution within genomic groups. BMC Genomics. 2019;20(1):441.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Fang LZ, Lei SC, Yan ZJ, Xiao X, Liu JW, Gong XQ, Yu H, Yu XJ. Detection of multiple intracellular bacterial pathogens in Haemaphysalis flava ticks collected from hedgehogs in Central China. Pathogens 2021, 10(2).

  33. Zhu C, Ai L, Qi Y, Liu Y, Li H, Ye F, Wang Q, Luo Y, Tan W, Shi C. Molecular detection of spotted fever group rickettsiae in hedgehogs (Erinaceus amurensis) and hedgehog-attached ticks in Xuyi County, Southeast China. Exp Appl Acarol. 2022;88(1):97–111.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Rahal M, Tahir D, Eldin C, Bitam I, Raoult D, Parola P. Genotyping of Coxiella burnetii detected in placental tissues from aborted dairy cattle in the north of Algeria. Comp Immunol Microbiol Infect Dis. 2018;57:50–4.

    Article  CAS  PubMed  Google Scholar 

  35. Selim A, Abdelrahman A, Thiery R, Sidi-Boumedine K. Molecular typing of Coxiella burnetii from sheep in Egypt. Comp Immunol Microbiol Infect Dis. 2019;67:101353.

    Article  PubMed  Google Scholar 

  36. Vranakis I, Mathioudaki E, Kokkini S, Psaroulaki A. Com1 as a promising protein for the Differential diagnosis of the two forms of Q fever. Pathogens 2019, 8(4).

  37. Zhang J, Wen B, Chen M, Zhang J, Niu D. Balb/c mouse model and real-time quantitative polymerase chain reaction for evaluation of the immunoprotectivity against Q fever. Ann N Y Acad Sci. 2005;1063:171–5.

    Article  CAS  PubMed  Google Scholar 

  38. Prudent E, Lepidi H, Angelakis E, Raoult D. Fluorescence in situ hybridization (FISH) and peptide nucleic acid probe-based FISH for diagnosis of Q fever endocarditis and vascular infections. J Clin Microbiol 2018, 56(9).

  39. Duron O, Sidi-Boumedine K, Rousset E, Moutailler S, Jourdain E. The importance of Ticks in Q Fever transmission: what has (and has not) been demonstrated? Trends Parasitol. 2015;31(11):536–52.

    Article  PubMed  Google Scholar 

  40. Wang S, Xu K, Wang G. Delayed diagnosis of persistent Q fever: a case series from China. BMC Infect Dis. 2024;24(1):591.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Liu B, Huang P, Liang Y, Liu S, Chen F, Luo X, Xu T, Xie B. Acute Q fever pneumonia diagnosed by metagenomic next-generation sequencing. J Infect Dev Ctries. 2024;18(5):834–8.

    Article  PubMed  Google Scholar 

  42. Wang D, Zhang L, Cai Z, Liu Y. Diagnosis of Acute Q Fever in a patient by using Metagenomic Next-Generation sequencing: a Case Report. Infect Drug Resist. 2023;16:1923–30.

    Article  PubMed  PubMed Central  Google Scholar 

  43. Song K, Ji Y, Sun S, Yue X, Wang C, Luo T, Moming A, Song Y, Zhang Y, Yang R. Bacterial microbiota in unfed ticks (Dermacentor nuttalli) from xinjia ng detected through 16S rDNA amplicon sequencing and Culturomics. Zoonoses 2021, 1(1).

  44. España PP, Uranga A, Cillóniz C, Torres A. Q fever (Coxiella Burnetii). Semin Respir Crit Care Med. 2020;41(4):509–21.

    Article  PubMed  Google Scholar 

  45. Signs KA, Stobierski MG, Gandhi TN. Q fever cluster among raw milk drinkers in Michigan, 2011. Clin Infect Dis. 2012;55(10):1387–9.

    Article  PubMed  Google Scholar 

  46. Benson WW, Brock DW, Mather J, SEROLOGIC ANALYSIS OF A PENITENTIARY GROUP USING RAW MILK FROM A Q FEVER INFECTED HERD. Public Health Rep (1896). 1963;78(8):707–10.

    Article  CAS  PubMed  Google Scholar 

  47. Seo MG, Lee SH, VanBik D, Ouh IO, Yun SH, Choi E, Park YS, Lee SE, Kim JW, Cho GJ, et al. Detection and genotyping of Coxiella burnetii and Coxiella-Like Bacteria in horses in South Korea. PLoS ONE. 2016;11(5):e0156710.

    Article  PubMed  PubMed Central  Google Scholar 

  48. McCaul TF, Williams JC. Developmental cycle of Coxiella burnetii: structure and morphogenesis of vegetative and sporogenic differentiations. J Bacteriol. 1981;147(3):1063–76.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Bielawska-Drozd A, Cieslik P, Zakowska D, Glowacka P, Wlizlo-Skowronek B, Zieba P, Zdun A. Detection of Coxiella burnetii and Francisella tularensis in tissues of wild-living animals and in Ticks of North-West Poland. Pol J Microbiol. 2018;67(4):529–34.

    Article  PubMed  PubMed Central  Google Scholar 

  50. Theonest NO, Carter RW, Kasagama E, Keyyu JD, Shirima GM, Tarimo R, Thomas KM, Wheelhouse N, Maro VP, Haydon DT, et al. Molecular detection of Coxiella burnetii infection in small mammals from Moshi Rural and Urban districts, northern Tanzania. Vet Med Sci. 2021;7(3):960–7.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

We would like to express our sincere thanks to all the participants for their contributions to the study.

Funding

This study was funded by Project of Medical Research Topics of Jiangsu Provincial Health Planning Commission (H2019015, M2020087), Jiangsu Science and Technology Plan (BK20221196, BE2022682), and Incubation Project of Huadong Research Institute for Medicine and Biotechniques (2024YQZL02).

Author information

Author notes

  1. Lele Ai, Yong Qi and Yue Hu contributed equally to this work.

Authors and Affiliations

  1. Nanjing Bioengineer (Gene) Center for Medicines, Nanjing, China

    Lele Ai, Yong Qi, Changqiang Zhu, Fuqiang Ye, Yifan Wu, Qiyuan Kuai, Danyue Nie & Weilong Tan

  2. Jinling Hospital, School of Medicine, Nanjing University, Nanjing, China

    Yue Hu, Laiyou Shan & Yan Zhang

  3. Yancheng Center for Disease Control and Prevention, Yancheng, China

    Feng Li

  4. Eastern Theater General Hospital, Nanjing, China

    Han Dai

  5. Center for Disease Control and Prevention of PLA, Beijing, China

    Changjun Wang

  6. Institute of Rocket Force Medicine, State Key Laboratory of Trauma, Burns and Combined Injury, Army Medical University, Chongqing, China

    Changqiang Zhu & Kangle Liu

Authors
  1. Lele Ai
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yong Qi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yue Hu
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Changqiang Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Kangle Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Feng Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Fuqiang Ye
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Han Dai
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Yifan Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Qiyuan Kuai
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Danyue Nie
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Laiyou Shan
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Yan Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  14. Changjun Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  15. Weilong Tan
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

W-LT designed the experiments. L-LA, Q-YK and YQ wrote the manuscript and carried out the analysis. YH, FL, F-QY, K-LL, Y-FW, D-YN and C-QZ involved in laboratory works. HD, YZ, L-YS and C-JW critically revised the manuscript, and all authors approved the submission.

Corresponding author

Correspondence to Weilong Tan.

Ethics declarations

Ethics approval and consent to participate

Informed consent was obtained from all subjects and/or their legal guardian(s). The use of human and animal samples was reviewed and approved by the Ethics Committee of Huadong Research Institute for Medicine and Biotechniques and the animal care and treatment met the standard of the committee, with all efforts made to minimize suffering. All methods were performed in accordance with the relevant guidelines and regulations (Approval number: 2018006).

Consent for publication

There are no details on individuals reported within the manuscript.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ai, L., Qi, Y., Hu, Y. et al. The epidemiological and infectious characteristics of novel types of Coxiella burnetii co-infected with Coxiella-like microorganisms from Xuyi County, Jiangsu province, China. BMC Infect Dis 24, 1041 (2024). https://doi.org/10.1186/s12879-024-09924-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12879-024-09924-7

Keywords

BMC Infectious Diseases

ISSN: 1471-2334

Contact us