Skip to main content

Table 1 Sequences of primers for detection of HBV genotypes and mutations

From: Molecular evaluation of hepatitis B virus infection and predominant mutations of pre-core, basal core promoter and S regions in an Iranian population with type 2 diabetes mellitus: a case–control study

Virus Primers name Sequences of Primers 5′ → 3′ Gene Region in genome Annealing temperature Size References
HBV 244-HBS-F1 GAGTCTAGACTCGTGGTGGACTTC S 244–267 56 ℃ 447 bp [19,20,21]
  691-HBS-R1 AAATKGCACTAGTAAACTGAGCCA   668–691    
  255-HBS-F2 CGTGGTGGACTTCTCTCAATTTTC   255–278 56 ℃ 416 bp  
  671-HBS-R2 GCCARGAGAAACGGRCTGAGGCCC   648–671    
HBV 1606-pre-C-F1 GCATGGAGACCACCGTGAAC X and pre-core regions 1606–1625 57 ℃ 789 bp [21,22,23]
  2395-pre-C-R1 AGGCGAGGGAGTTCTTCTTC   2376–2395    
  1653-pre-C-F2 CATAAGAGGACTCTTGGACT   1653–1672 55 ℃ 740 bp  
  2393-pre-C-R2 GCGAGGGAGTTCTTCTTC   2376–2393