Skip to main content
Fig. 5 | BMC Infectious Diseases

Fig. 5

From: The first case report of thorn-induced Alternaria alternata infection of the hand in an immunocompetent host

Fig. 5

Phylogenetic tree constructed based on internal transcribed spacer (ITS) gene sequence of Alternaria alternata. Gene sequencing analysis of ITS gene, amplified with the primer pair ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′TCCTCCGCTTATTGATATGC)-3′, indicated Alternaria alternata. Alternaria alternata was confirmed with an 100% accuracy using the basic local alignment search tool algorithm. (*, patient). Scale bar indicated nucleotide substitutions per site

Back to article page

BMC Infectious Diseases

ISSN: 1471-2334

Contact us