Skip to main content

Table 1 LAMP E gene and RdRp gene primers used in this study

From: Two extraction-free reverse transcription loop-mediated isothermal amplification assays for detection of SARS-CoV-2

Primer Sequence (5′–3′)
E gene
 FIP CGCAGTAAGGATGGCTAGTGTAGCGTACTTCTTTTTCTTGCTT
 BIP TCGATTGTGTGCGTACTGCTGTTTTTAACACGAGAGTAAACGT
 FLP CTAGCAAGAATACCACG
 BLP GTTAACGTGAGTCTTG
 F3 TTTCGGAAGAGACAGGTAC
 B3 AGGAACTCTAGAAGAATTCAGA
RdRp gene
 FIP TGAGCACACTCATTAGCTAATCTCGCAAACATACAACGTGTTG
 BIP GAGTGAAATGGTCATGTGTGGAAGCAGTTGTGGCATCTC
 FLP GAAACGGTGTGACAAGCT
 BLP GTTAAACCAGGTGGAACCTC
 F3 TGGCCTCACTTGTTCTTG
 B3 AGCTTGACAAATGTTAAAAACAC