Skip to main content

Table 1 Specific primers used in this study

From: A fatal case of acute encephalopathy in a child due to coxsackievirus A2 infection: a case report

Primer Sequences (5′→3′) Polarity Positiona Identity %
CA2_F1 TGTGTGGTTAACAAAAATAGTG Forward 2643–2664 22/22 100
CA2_R1 TGGTAGCCACAAACGTGAACTC Reverse 2859–2838 22/22 100
CA2_F2 TAACAAAAATAGTGTGGAAGAGG Forward 2651–2673 23/23 100
CA2_R2 ACAAACGTGAACTCAGCATTG Reverse 2851–2831 21/21 100
  1. aVP1 region of CV-A2 at strain 431135 (JX867332.1)