Table 1 Primers and PCR amplification and sequencing protocols of partial rpoB gene sequence
Gene | Fragment | Primers | PCR condition | Position (aa) |
|---|---|---|---|---|
rpoB | 1 | rpoB-1F: CAACAACAACACCGGTGAGA rpoB-1R: CTGGTTTTGGATCAGCTCGC | 94 °C × 5′ 45c: (94 °C × 45″–66 °C c 1′–72 °C × 45″) 72 °C × 10′ | 135–382 |
2 | rpoB-2F: GTACGGTCGGCGAGCTGA rpoB-2R: CCTGGCGCTGCATGTTTG | 94 °C × 5′ 45c: (94 °C × 45″–66 °C c 1′–72 °C × 45″) 72 °C × 10′ | 376–610 |