Skip to main content

Table 1 Overview of the reagents and assays used for the molecular (a) and serological (b) analyses

From: Tick-transmitted co-infections among erythema migrans patients in a general practice setting in Norway: a clinical and laboratory follow-up study

(a)
Microorganism Primer/probe Nucleotide sequence (5′ → 3′) Target gene References  
SFG Rickettsia spp. CS-F TCGCAAATGTTCACGGTACTTT gltA [22]  
CS-R TCGTGCATTTCTTTCCATTGTG  
CS-P FAM-TGCAATAGCAAGAACCGTAGG CTGGATG-BHQ1  
A. phagocytophilum ApF TTTTGGGCGCTGAATACGAT gltA [6]  
ApR TCTCGAGGGAATGATCTAATAACGT  
ApM FAM-TGCCTGAACAAGTTATG-BHQ1  
N. mikurensis Forward CGGAAATAACAAAAGATGGA groEL [12]  
Reverse ACCTCCTCGATTACTTTAG  
Probe 6FAM-TTGGTGATGGAACTACA-MGB  
Babesia spp. BJ1 GTCTTGTAATTGGAATGATGG 18S rRNA [24]  
BN2 TAGTTTATGGTTAGGACTACG  
(b)
Microorganism Method Manufacturer Antigen IgG cut-off IgM cut-off
SFG Rickettsia spp. Indirect IFA Focus Diagnostics Inactivated R. rickettsii 1:64 1:64
A. phagocytophilum Indirect IFA Focus Diagnostics Infected HL60 cells 1:64 1:20
Babesia microti Indirect IFA Focus Diagnostics Infected erythrocytes 1:64
Bbsl Indirect ELISA Enzygnost (Siemens) VlsE a
TBEV Indirect ELISA 1. Virion/Serion
2. Euroimmun
1. Inactivated TBEV prepared from strain Moscow B-4
2. Inactivated TBEV prepared from strain K23
1b. 2c
  1. FAM 6-carboxy-fluorescine, BHQ Black Hole Quencher, MGB minor groove binder
  2. aAccording to manufacturer’s instructions
  3. bFor Virion/Serion cut-offs are calculated for each batch according to manufacturer’s instructions
  4. cFor Euroimmun there is a fixed negative cut-off of < 120 VIEU/ml