Skip to main content

Table 2 LAMP primer sets used in this study

From: LAMP assays for the simple and rapid detection of clinically important urinary pathogens including the detection of resistance to 3rd generation cephalosporins

Target Primer name Sequences (5′à 3′) References
CTX-M groupe 1 F3 CACTGCGTCAGTTCACGC Rivoarilala et al. [21]
B3 CACGGCCATCACTTTACTGG
FIP TTGCTGTACGTCCGCCGTTTGTTTTCAACCGTCACGCTGTTGT
BIP CAGTCGGGAGGAAGACTGGGTTTTTGCGCTCATCAGCACGATA
LF TACAGCGGCACACTTCCTA
P. mirabilis (walR) F3 AAAAAACGCGGWTCTGCA This study
B3 AAGACAGATAGAGCCAACG
FIP CTGTCGAGCTATGGGTATTAATCACTTTTATTGCGTAATTGGTTAAAARTC
BIP GTTAGTTGCGCTATCTTGTGCTTCTTTTGAACGTGATACATCGGTAGA
LF CCGCCATAGTACGTACTCGCCA
E. coli F3 GCCATCTCCTGATGACG Hill et al. [24]
B3 ATTTACCGCAGCCAGACG
FIP CTGGGGCGAGGTCGTGGTATTCCGACAAACACCACGAATT
BIP CATTTTGCAGCTGTACGCTCGCAGCCCATCATGAATGTTGCT
LF CTTTGTAACAACCTGTCATCGACA
LB ATCAATCTCGATATCCATGAAGGTG
K. pneumoniae F3 GGATATCTGACCAGTCGG Dong et al., [25]
B3 GGGTTTTGCGTAATGATCTG
FIP CGACGTACAGTGTTTCTGCAGTTTTAAAAAACAGGAAATCGTTGAGG
BIP CGGCGGTGGTGTTTCTGAATTTTGCGAATAATGCCATTACTTTC
LB GAAGACTGTTTCGTGCATGATGA
E. faecalis F3 GCCGGAAATCGATGAAGA Kato et al. [26]
B3 TCCAGCAACGTTGATTGT
FIP CACTTTTTGTTGTTGGTTTTCGCTTTATTATCTGCTTGGGGTGC
BIP ATCTGCAGACAAAGTAGTAATTGCTCCAAGCTTTTAAGCGTGTC
LF AAATGCTGCGCCAGCTCG
  LB TCCAATGTGGAACTTAAACGTACC