Skip to main content

Table 2 LAMP primers from the three different studies

From: Evaluation of different DNA extraction methods and loop-mediated isothermal amplification primers for the detection of Mycobacterium ulcerans in clinical specimens

Ablordey et al, 2012 [8]
Buruli-FIP:GTGCGCCGTGTCCGGTATGGATACGCGATGTCACCTTC
Buruli- BIP: AGGTCCTAGCAACGCTACGCAAATCCGGCAGGCTTCGG
Buruli-LF: GCCTTTGACGGTCTTCGTC
Buruli- LB: CACCGCGATCAATCTGCAC
Buruli- F3: CGAGAACAGCCTGCACTG
Buruli- B3: CGGTTGGCGGTCAAAGC
Njiru et al, 2012 [23]
MU2404-FIP: CGTCGCGTATCCAGTGCAGGTCATGACCTGGATGCGTCA
MU2404-BIP: GCGCACAGGTCCTAGCAACGGCTTCGGCGATGTTGTCG
MU2404-F3:GCCTGCCGTTCGAGCA
MU2404-B3:GTCAAAGCGGTGATCCGG
MU2404-FLP:TTCTCGATTCCGCAGTG
MU2404-BLP:GCAACACCGCGATCAATCTG
de Souza et al, 2012 [16]
BU-LAMP FIP: GCATCTCCGGCCACCCCAACGCCCAACGACCGCTA
BU-LAMP BIP:GTGGTGGGCCCCTGGGAAACCGCTGTCGAACTGTGC
BU-LAMP F3: ACGGATCGTCGAGGATGG
BU-LAMP B3:GCGCCAGGTCCCTTGA
BU-LAMP FLP:GAGCCTGCTGGGCGGTC
BU-LAMP BLP: CAGATCCCACCCTGGTG