Skip to main content

Table 1 IS2404 nested PCR primers

From: Evaluation of different DNA extraction methods and loop-mediated isothermal amplification primers for the detection of Mycobacterium ulcerans in clinical specimens

Primers Sequence (5′-3′) Expected Amplicon size (bp)
pGp1 AGGGCAGCGCGGTGATACGG 518
pGp2 CAGTGGATTGGTGCCGATCGAG
pGp3 GGCGCAGATCAACTTCGCGGT 212
pGp4 CTGCGTGGTGCTTTACGCGC