Skip to main content

Table 1 Genes, primer sequences, annealing temperatures and predicted size of PCR products

From: Antibiotic susceptibility of human-associated Staphylococcus aureus and its relation to agr typing, virulence genes, and biofilm formation

Gene Protein Primer sequence (5′-3′) Product size (bp) 1Annea.(°C) 2Ref.
crtN Staphyloxanthin ATTGATCCAAAACGAGGCCC/ CGGCCCGTTTGAATTTAGGA 196 55 This study
Surface factors
cap5H CP5 synthesis enzyme ATGAGGATAGCGATTGAAAA/ CGCTTCTTAATCACTTTTGC 518 50 [3]
cap8H CP8 synthesis enzyme ATCGAAGAACATATCCAAGG/ TTCATCACCAATACCTTTTA 834 49 [3]
Hemolysins
hla Alfa toxin TGCCGCAGATTCTGATATTAA/ TTTCTGAAGAACGATCTGTCCA 845 55 [3]
hlb Beta toxin GCGGTTGTGGATTCGATAAT/ GGCTTTGATTGGGTAATGATC 524 55 [3]
hld Delta toxin GGGATGGCTTAATAACTCATACTT/ CAGAGATGTGATGGAAAATAGTTGA 236 62 [3]
Superantigenic toxins
tst Toxic shock syndrome toxin-1 ACCCCTGTTCCCTTATCATC/ TTTTCAGTATTTGTAACGCC 326 52 [19]
eta Exfoliative toxin A CTAGTGCATTTGTTATTCAA/ TGCATTGACACCATAGTACT 119 50 [20]
etb Exfoliative toxin B ACAAGCAAAAGAATACAGCG/ GTTTTTGGCTGCTTCTCTTG 226 52 [19]
sea Enterotoxin A GGTTATCAATGTGCGGGTGG/ CGGCACTTTTTTCTCTTCGG 102 56 [19]
seb Enterotoxin B GTATGGTGGTGTAACTGAGC/ CCAAATAGTGACGAGTTAGG 164 55 [19]
sec Enterotoxin C AGATGAAGTAGTTGATGTGTATGG/ CACACTTTTAGAATCAACCG 451 52 [19]
sed Enterotoxin D CCAATAATAGGAGAAAATAAAAG/ ATTGGTATTTTTTTTCGTTC 278 48 [19]
see Enterotoxin E AGGTTTTTTCACAGGTCATCC/ CTTTTTTTTCTTCGGTCAATC 209 52 [19]
  1. 1: Annealing temperature, 2: reference