Skip to main content

Table 2 Primers used in this study for amplification and sequencing

From: Molecular characterization of multidrug-resistant tuberculosis against levofloxacin, moxifloxacin, bedaquiline, linezolid, clofazimine, and delamanid in southwest of China

ATB drug Gene Primer Length
FQs gyrA Forward TGACATCGAGCAGGAGATGC 320 bp
Reverse GGGCTTCGGTGTACCTCATC
gyrB Forward GTGGAAATATGTTGGCCGTC 413 bp
Reverse GTCGTTGTGAACAACGCTGTG
LZD 23S rRNA Forward GGTTGAAGACTGAGGGGATGAG 2422 bp
Reverse CATCGGCGCTGGCAGGCTTAG
rplC Forward GCTGCGGCTGGACGACTC 420 bp
Reverse CTCTTGCGCAGCCATCACTTC
rplD Forward CCGGGCGGATGGGCAATGACC 936 bp
Reverse GGAATCCGGGCGCACCAAAAAC
BDQ atpE Forward TGTACTTCAGCCAAGCGATGG 454 bp
Reverse CCGTTGGGAATGAGGAAGTTG
pepQ Forward ATCAATGCCCCCTGGAAC 1371 bp
Reverse GCACGTTCTTCAACTTGGTG
CFZ rv1979c Forward GCGGCGGAAATGAGTGT 1647 bp
Reverse ATGCACGACGGCTTTATCA
BDQ/ CFZ rv0678 Forward TGCCTTCGGAACCAAAGAA 795 bp
Reverse GACAACACGGTCACCTACAA
DLM fbiA Forward CGGTTCTGTTGTGGTTGGG 1136 bp
Reverse CCGATGACGGGCAGGATC
fbiB Forward GCCGCTGCTGATGACCGA 1494 bp
Reverse TCGGGAGGTTGATGGTTGG
fbiC Forward GTCCACCGCTCTGCCGAGTC 2386 bp
Reverse GCCACCTTCGAGCATCACC
fgd1 Forward TCGCGTTTATGGCATAGGAGT 1090 bp
Reverse ACTTACCCGTCTGCGATTCTG
ddn Forward CACCATCATCGAGCGGATTT 765 bp
Reverse CAAGGGCGTGAAATGGGAT