Skip to main content

Table 2 Primers and probes used for detection of F. tularensis

From: Francisella tularensis human infections in a village of northwest Iran

Gene target Primer and probe Sequence (5′ to 3′) Amplicon size (bp)
ISFtu2 ISFtu2-F TTGGTAGATCAGTTGGTAGGATAACC 97
ISFtu2-R TGAGTTTTATCCTCTGACAACAATATTTC
ISFtu2-Probe FAM-AAAATCCATGCTATGACTGATGCTTTAGGTAATCCA-TAMRA
fopA fopA-F AACAATGGCACCTAGTAATATTTCTGG 87
fopA-R CCACCAAAGAACCATGTTAAACC
fopA- Probe FAM-TGGCAGAGCGGGTACTAACATGATTGGT-TAMRA