Skip to main content

Table 4 Primers used for Campylobacter jejuni MLST

From: High prevalence of Campylobacter jejuni CC21 and CC257 clonal complexes in children with gastroenteritis in Tehran, Iran

Primer Forward Reverse Product size (bp) Reference
asp CCAACTGCAAGATGCTGTACC TTAATTTGCGGTAATACCATC 625 [17]
gln CATGCAATCAATGAAGAAAC TTCCATAAGCTCATATGAAC 722 [17]
glt GTGGCTATCCTATAGAGTGGC CCAAAGCGCACCAATACCTG 575 [17]
gly AGCTAATCAAGGTGTTTATGCGG AGGTGATTATCCGTTCCATCGC 648 [17]
pgm GGTTTTAGATGTGGCTCATG TCCAGAATAGCGAAATAAGG 700 [17]
tkt GCTTAGCAGATATTTTAAGTG ACTTCTTCACCCAAAGGTGCG 691 [17]
unc TGTTGCAATTGGTCAAAAGC TGCCTCATCTAAATCACTAGC 631 [17]
\