Skip to main content

Table 3 Specific primers used for Real-Time PCR

From: High prevalence of Campylobacter jejuni CC21 and CC257 clonal complexes in children with gastroenteritis in Tehran, Iran

Primer Forward sequence Reverse sequence Product size (bp) Reference
dnaK AAACGCCAAGCGGTAACTAA TTCTTTAGCCGCGTCTTCAT 90 [16]
16SrRNA AAGGGCCATGATGACTTGACG AGCGCAACCCACGTATTTAG 107 [16]
\