Skip to main content

Table 2 Primer used for identification of classes A, B and C

From: High prevalence of Campylobacter jejuni CC21 and CC257 clonal complexes in children with gastroenteritis in Tehran, Iran

ORF Forward sequence Reverse sequence Product size (bp) Reference
Orf7ab ACTACACTTTAAAACATTTAATCC AAAATCA CCATAAGCCTCACTAGAAGGTATGAGTATA 580 [6]
Orf 6ab1 CAAGGGCAATAGAAAGCTGTATCA ACAAGCACTTCATTCTTAGTATTACAAAT 631 [6]
Orf6ab2 TCATCTTGCCAACTTATAATGTGGA TCTAGCGATATTAAACCAACAGCCT 517 [6]
Orf5bII CTGTGATGATGGGAGTGAAGAGC GGTAATCGTTTCGGCGGTATT 539 [6]
Orf6c GTAGTAGATGATTGTGGTAATGATAAA ATAGAATTGCTATTTACATGCTGG 554 [6]
Orf7c TTGAAGATAGATATTTTGTGGGTAAA CTTTAAGTAGTGTTTTATGTCACTTGG 746 [6]