Skip to main content

Table 1 Primer sequences and annealing temperatures

From: Molecular mechanism of azoles resistant Candida albicans in a patient with chronic mucocutaneous candidiasis

NameSequences (5′-3′)Annealing temperature(°C)
ERG3-FGATCATAACTCAATATGG60
ERG3-RCTGAACACTGAATCG
ERG11-FATGGATATCGTACTAGAA60
ERG11-RTCATTGTTCAACATATTC
18S-FTCTTTCTTGATTTTGTGGGTGG58
18S-RTCGATAGTCCCTCTAAGAAGTG
CDR1-FGCTGGTGAAGGTTTGAATGT60
CDR1-RCGCTGATGGTTGATGGATAG
CDR2-FATCTGGTGCTGGTAAGAC54
CDR2-RGCTGATGGTTGATGGATAG