Skip to main content

Table 1 Nested RT-PCR and real time RT-PCR primers and probe used in this study

From: A case of SFTS coinfected with E. coli bacteremia

Target gene PCR Primer name Sequences Product
size (bp)
M segment Nested RT-PCR
(1st PCR)
SFTS-M 1st-F TCATCCTGACYTATTYTGCAATWG 640
SFTS-M 1st-R TAAGTYACACTCACACCCTTGAA
Nested RT-PCR
(2nd PCR)
SFTS-F (=MF3) GATGAGATGGTCCATGCTGATTCTAA 560
SFTS-R (=MR2) CTCATGGGGTGGAATGTCCTCAC
S segment Real-time
RT-PCR
SFTS-SQ-F ACCTCTTTGACCCTGAGTTWGACA 120
SFTS-SQ-R CTGAAGGAGACAGGTGGAGATGA
SFTS-SQ-P [FAM]-TGCCTTGACGATCTTA [NFQ-MGB]
\