Skip to main content

Table 1 RT-LAMP primers used for the rapid detection of ZIKV

From: A reverse transcription loop-mediated isothermal amplification for broad coverage detection of Asian and African Zika virus lineages

Primer a Sequence (5′ → 3′)
F3 GGCRGAYATWGAGATGGCTGG
B3 CACTCCAACYTGTGTTGAACC
FIP ACTT CC GC RT CYTT TT CC CATG TG AT GYTA YG TG GTCT CRGG AAAG AGTG T
BIP GAGAGA GA TC ATAC TCAA RGTG GT CC TTCT TY AC ATAY AC RT ACCA CG CT CC
FLP TGATRTCACCTGCTCTTTCAATGTACAT
BLP TGTGGCATGAACCCAATAGC
  1. a F3, forward outer primer; B3, backward outer primer; FIP Forward inner primer, BIP Backward inner primer; FLP Forward loop primer, BLP Backward loop primer