Skip to main content

Table 1 Primers and probes applied in this study

From: Evaluation of TaqMan Array card (TAC) for the detection of 28 respiratory pathogens

Pathogen Target gene Primer/probe sequence Reference or Source
INF-A M F, AAGACCAATCCTGTCACCTCTGA [2] (modified)
R, AAGCGTCTACGCTGCAGTCC
P, ACGCTCACCGTGCC
INF-B HA F, AAATACGGTGGATTAAACAAAAGCAA [25] (modified)
R, CCAGCAATAGCTCCGAAGAAA
P, TGGGCAATTTCCTATGGC
PIV-1 HN F, TGATTTAAACCCGGTAATTTCTCAT [26]
R, CCTTGTTCCTGCAGCTATTACAGA
P, ACGACAACAGGAAATC
PIV-2 HN F, AGGACTATGAAAACCATTTACCTAAGTGA [26] (modified)
R, AAGCAAGTCTCAGTTCAGCTAGATCA
P, TGTTCAGTCACTGCTATAC
PIV-3 HN F, AAAAGTTGATGAAAGATCAGATTATGCAT [26] (modified)
R, CCGGGACACCCAGTTGTG
P, AAAGGCAAAATAATATTTCTC
HMPV-A F F, AGAGATGTAGGCACCACAACTGC Beijing Genomics institution
R, CTGATCCTAGAGCCGTGCAAA
P, TTCATCATTGCAGCAAGA
HMPV-B F F, ACAATGGCAACTTTGCTTAAAGAA Beijing Genomics institution
R, GATTATAGGTGTGTCTGGTGCTGAA
P, ATATTCCACAAAATCAGAGGC
HRV 5′ UTR F, TTCCAGCCTGCGTGGC [1] (modified)
R, GAAACACGGACACCCAAAGTAGTC
P, CCCCTGAATGYGGC
HEV 5′ UTR F, GGTGYGAAGAGYCTATTGAGC Beijing Genomics institution
R, ACGGACACCCAAAGTAGTCG
R, TCCGGCCCCTGAAT
HAdV Hexon F, CCCAGTGGTCTTACATGCACAT [3] (modified)
R, GCCACGGTGGGGTTTCTAA
P, CCGGGTCTGGTGCAG
RSV-A N F, AGATCAACTTCTGTCATCCAGCAA [25] (modified)
R, TTCTGCACATCATAATTAGGAGTATCAAT
P, CGGAGCACAGGAGAT
RSV-B N F, AAGATGCAAATCATAAATTCACAGGA [27]
R, TGATATCCAGCATCTTTAAGTATCTTTATAGTG
P, CTGGACATAGCATATAAC
M. pneumoniae P1 F, GCAGTTGCTGGCGCTAAGTT Beijing Genomics institution
R, AAGCGAGGTACGGTAGCGGTAT
P, TGGTAGGGAACTCGTTTTA
C. pneumoniae MOMP F, CGTGGAGCCTTATGGGAATG Beijing Genomics institution
R, CGTCTGTTGGCAAGGGGA
P, CAGTCCAAACCTAAAGTT
S. pneumoniae lytA F, ACGCAATCTAGCAGATGAAGCA [1] (modified)
R, TCGTGCGTTTTAATTCCAGCT
P, AACGCTTGATACAGGGAG
M. tuberculosis orfB F, GGCTGTGGGTAGCAGACC [28] (modified)
R, CGGGTCCAGATGGCTTG
P, ACCTGGGCAGGGTT
HBOV NP1 F, AGAGGCTCGGGCTCATATCA [29] (modified)
R, CACTTGGTCTGAGGTCTTCGAA
P, CAATCARCCACCTATCGTCT
Measles virus P F, GCAATTGGATCAACTGAAGGC Beijing Genomics institution
R, AGAGTCAGCATCTTGGATTCCCT
P, ACAGCGGTGAAGCG
Rubella Virus E1 F, ACGCCGCACGGACAACT Beijing Genomics institution
R, TGTTGGTTGCCGGTGTAATTC
P, AGGTCCCGCCCGAC
Mumps virus P F, GCAATTGGATCAACTGAAGGC Beijing Genomics institution
R, AGAGTCAGCATCTTGGATTCCCT
P, ACAGCGGTGAAGCG
Coxiella burnetii ICD F, AATTTGGAGCAAAGCCCTTAGA Beijing Genomics institution
R, GTAAAAAGGCGTCGGCAATAAC
P, ACCCTGGCATGTCT
HCoV-229E N F, CAGTCAAATGGGCTGATGCA [25] (modified)
R, CAAAGGGCTATAAAGAGAATAAGGTATTCT
P, AACGTGGTCGTCAGGG
HCoV-NL63 N F, GCGTGTTCCTACCAGAGAGGAA [25] (modified)
R, GCTGTGGAAAACCTTTGGCA
P, TGCTTTGGTCCTCGTGAT
HCoV-OC43 N F, CGATGAGGCTATTCCGACTAGGT [30] (modified)
R, CCTTCCTGAGCCTTCAATATAGTAACC
P, TGGCACGGTACTCC
HCoV-HKU N F, AGGGATCCTACTAYTCAAGAAGCTATCC [3] (modified)
R, ATGAACGATTATTGGGTCCACG
P, CGCCTGGTACGATTT
Pan-Legionella 5S–23S F, GTACTAATTGGCTGATTGTCTTGACC [1] (modified)
R, CCTGGCGATGACCTACTTTCG
P, ACTCTTTACCAAACCTG
H. influenzae bexA F, GGACAAACATCACAAGCGGTTA [1] (modified)
R, TGCGGTAGTGTTAGAAAATGGTATTATG
P, TTGTAGTATTGATACGCTTTGT
B. pertussis target I IS481a F, CAAGGCCGAACGCTTCAT [1] (modified)
R, GAGTTCTGGTAGGTGTGAGCGTAA
P, CCTTGCGTGAGTGGG
B. pertussis target II PtxA F, GCCGCCAGCTCGTACTTC [1] (modified)
R, GGATACGGCCGGCATTG
P, CGTCGACACTTATGGCGA
IPCO    ABI
RNP RPP30 F, AGATTTGGACCTGCGAGCG WHO (modified)
R, GAGCGGCTGTCTCCACAAGT
P, CTGAAGGCTCTGCGC