Skip to main content

Table 1 The sequence lists of the primers used in Q-PCR analysis

From: Antiviral mechanism of carvacrol on HSV-2 infectivity through inhibition of RIP3-mediated programmed cell necrosis pathway and ubiquitin-proteasome system in BSC-1 cells

Genes Primer sequence (5′-3′) Length (bp)
ICP4 Forward GATGGGGTGGCTCCAGAAC 103
Reverse AGATGAAGGAGCTGCTGTTGC
ICP27 Forward CCCTTTCTGCAGTGCTACCT 95
Reverse CCTTAATGTCCGACAGGCGT
VP16 Forward AATGTGGTTTAGCTCCCGCA 103
Reverse CCAGTTGGCGTGTCTGTTTC
gB Forward CCATGACCAAGTGGCAGGAG 103
Reverse AGGTTGGTGGTGAAGGTGGTC
UL-30 Forward AGATCAAGGTGAACGGGATGG 141
Reverse GTCGCGGTAGCTCAGATCCTT
GAPDH Forward CAAGAAGGTGGTGAAGCAGGC 171
Reverse CATACCAGGAAATGAGCTTGAC
RIP-3 Forward CATAGGAAGTGGGGCTACGAT 95
Reverse AATTCGTTATCCAGACTTGCCAT
MLKL Forward AGGAGGCTAATGGGGAGATAGA 70
Reverse TGGCTTGCTGTTAGAAACCTG
TNF-α Forward GAGGCCAAGCCCTGGTATG 91
Reverse CGGGCCGATTGATCTCAGC
TNF-R1 Forward TCACCGCTTCAGAAAACCACC 96
Reverse GGTCCACTGTGCAAGAAGAGA