Skip to main content

Table 1 Primers used and their sequences

From: Evaluation of the performance of an in-house duplex PCR assay targeting the IS6110 and rpoB genes for tuberculosis diagnosis in Cameroon

Gene (PCR product size bp) Primer name Primer sequence (5′- 3′) Annealing temperature
rpoB (235) rpoBF TACGGTCGGCGAGCTGATCCAAA 68 °C
rpoBR ACAGTCGGCGCTTGTGGGTCAAC  
IS6110 (123) IS6110F CCTGCGAGCGTAGGCGTCGG 63 °C
IS6110R CTCGTCCAGCGCCGCTTCGG