Skip to main content

Table 1 Primers used in this study for amplification of 16S rRNAmethyltransferase genes

From: Expansion of acquired 16S rRNA methytransferases along with CTX-M-15, NDM and OXA-48 within three sequence types of Escherichia coli from northeast India

Target primers Sequence (Forward& reverse-5'-3') Amplicon size (bp) Reference
armA GGTGCGAAAACAGTCGTAGT 1153 [22]
TCCTCAAATATCCTCTATGT
rmtA CTAGCGTCCATCCTTTCCTC 635 [22]
TTTGCTTCCATGCCCTTGCC
rmtB GGAATTCCATATGAACATCAACGATGCC 756 [22]
CCGCTCGAGTCCATTCTTTTTTATCAAGT
rmtC CGAAGAAGTAACAGCCAAAG 1000 [22]
GCTAGAGTCAAGCCAGAAAA
rmtD TCATTTTCGTTTCAGCAC 744 [22]
AAACATGAGCGAACTGAAGG
npmA CGGGATCCAAGCACTTTCATACTGACG 981 [22]
CGGAATTCCAATTTTGTTCTTATTAGC
rmtE ATGAATATTGATGAAATGGTTGC 818 [23]
TGATTGATTTCCTCCGTTTTTG
rmtF GCGATACAGAAAACCGAAGG 589 [24]
ACCAGTCGGCATAGTGCTTT
rmtG AAATACCGCGATGTGTGTCC 250 [25]
ACACGGCATCTGTTTCTTCC
rmtH AATGACCATTGAACAGGCAGC 760 [26]
TCAAGCTGGGTTTGGCTGGA