Skip to main content

Table 1 Oligonucleotide primers used for amplification of virulence genes among UPEC isolates

From: Biofilm formation, antimicrobial susceptibility and virulence genes of Uropathogenic Escherichia coli isolated from clinical isolates in Uganda

Primer name Oligonucleotide sequence (5′-3′) Sizes (bp) Gene
PapC-F GACGGCACTGCTGCAGGGTGTGGCG 328 papC
Pap-C-R ATATCCTTTCTGCAGGGATGCAATA   
Fim-H-F TGTACTGCTGATGGGCTGGTC 564 fimH
Fim-H-R GGGTAGTCCGGCAGAGTAACG   
Sfa-F CTCCGGAGAACTGGGTGCATCTTAC 410 Sfa
Sfa-R CGGAGGAGTAATTACAAACCTGGCA   
Afa-F GCTGGGCAGCAAACTGATAACTCTC 750 Afa
Afa-R CATCAAGCTGTTTGTTCGTCCGCCG   
HlyA-F AACAAGGATAAGCACTGTTCTGGCT 1177 hlyA
HlyA-R ACCATATAAGCGGTCATTCCCGTCA   
Cnf1-F AAGATGGAGTTTCCTATGCAGGAG 498 cnf1
Cnf1-R TGGAGTTTCCTATGCAGGAG   
  1. Primers and sequences adapted from Ruike Zhao et al 2015