Genotypic and phenotypic characterization of Mycobacterium tuberculosis resistance against fluoroquinolones in the northeast of Iran

Table 1 Nucleotide sequence of primers and the amplicon size

Target organism	Gene	Primer sequence	Amplicon size	T_m	Reference
M. tuberculosis	gyrA	F: CAGCGCAGCTACATCGACTA	356 bp	61	[27]
	gyrA	R: CTCAGCATCTCCATCGCCAA	356 bp	61	[27]
	gyrB	F: GCAACACCGAGGTCAAATC	710 bp	57	[29]
	gyrB	R: ACCCTTGTACCGCTGAATG	710 bp	57	[29]

ISSN: 1471-2334