Skip to main content

Table 1 Nucleotide sequence of primers and the amplicon size

From: Genotypic and phenotypic characterization of Mycobacterium tuberculosis resistance against fluoroquinolones in the northeast of Iran

Target organism Gene Primer sequence Amplicon size Tm Reference
M. tuberculosis gyrA F: CAGCGCAGCTACATCGACTA 356 bp 61 [27]
R: CTCAGCATCTCCATCGCCAA
gyrB F: GCAACACCGAGGTCAAATC 710 bp 57 [29]
R: ACCCTTGTACCGCTGAATG