Skip to main content

Table 1 Oligonucleotide primer sequences used for Nested PCR in this research

From: Development of a convenient detection method for Trichomonas vaginalis based on loop-mediated isothermal amplification targeting adhesion protein 65

NameSequences(5′-3′)Description
OUT-FTCTGGAATGGCTGAAGAAGACGForward primer for the actin gene of T. vaginalis in the first stage
OUT-RCAGGGTACATCGTATTGGTCReverse primer for the actin gene of T. vaginalis in the first stage
IN-FCAGACACTCGTTATCGForward primer for the actin gene of T. vaginalis in the second stage
IN-RCGGTGAACGATGGATGReverse primer for the actin gene of T. vaginalis in the second stage
AP65-FIPGCCGACATAGAAGGATGGGA
CGCCCACTCAACCCAAAGGC
Forward inner primer for the AP65 gene of T. vaginalis in LAMP assay
AP65-BIPCCTCTACTCCTCTGGCCGTACAA
ACTGTGTGGGAAACACCAT
Backward inner primer for the AP65 gene of T. vaginalis in LAMP assay
AP65-F3CAACAGAGCACCCAGTTCTTForward outer primer for the AP65 gene of T. vaginalis in LAMP assay
AP65-B3TGTGGAAGGGAGTAGCCTTBackward outer primer for the AP65 gene of T. vaginalis in LAMP assay