Skip to main content

Table 1 The primers used in this study

From: Molecular identification and antifungal susceptibility profile of yeast from vulvovaginal candidiasis

Candida species Primer name Forward(5′-3′) Reverse(5′-3′) Amplified fragment size (bp) References
C. albicans complexes HWP1 GCTACCACTTCAGAATCATCATC GCACCTTCAGTCGTAGAGACG C. albicans:839 and 941
C. africana:700
C. dubliniensis:569
Shan,2014
C. glabrata complexes GLA
NIV
BRA
CGGTTGGTGGGTGTTCTGC
AGGGAGGAGTTTGTATCTTTCAAC
GGGACGGTAAGTCTCCCG
ACCAGAGGGCGCAATGTG C. glabrata:397
C. bracarensis: 223
C. nivariensis:293
Li,2014
C. parapsilosis complexes mCPF
mCOF
mCMF
TTTGCTTTGGTAGGCCTTCTA
TAAGTCAACTGATTAACTAAT
AACTGCAATCCTTTTCTTTCTA
AATATCTGCAATTCATATTACT C. parapsilosis:171
C. orthopsilosis:109
C. metapsilosis:217
Asadzadeh,2015
Rare yeast NL1,NL4 GCATATCAATAAGCGGAGGAAAAG-3’ GGTCCGTGTTTCAAGACGG 500–600 Leaw,2006
  1. 1Shan Y, Fan S, Liu X, et al. Prevalence of Candida albicans-closely related yeasts, Candida africana and Candida dubliniensis, in vulvovaginal candidiasis. Med Mycol, 2014, 52 (6): 636–40.
  2. 2Li J, Shan Y, Fan S, et al. Prevalence of Candida nivariensis and Candida bracarensis in vulvovaginal Candidiasis. Mycopathologia, 2014, 178 (3, 4): 279–83.
  3. 3Asadzadeh M, Ahmad S, Hagen F, et al. Simple, Low-Cost Detection of Candida parapsilosis complex isolates and molecular fingerprinting of Candida orthopsilosis strains in Kuwait by ITS region sequencing and amplified fragment length polymorphism analysis. PLoS One, 2015, 10 (11): e0142880.
  4. 4Leaw SN, Chang HC, Sun HF, et al. Identification of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J Clin Microb, 2006, 44 (3): 693–9.