Skip to main content

Table 2 Sequences of the primers and probes used for the RAA assay

From: Use of a rapid recombinase-aided amplification assay for Mycoplasma pneumoniae detection

Primer/probeSequence (5′-3′)Genomic positionProduct size (bp)
F-primerCTTTAACAATAACCGCTGGTTTGAATATGTA182,540–182,570164 bp
R-primerCTACTAAGTTCAGGTTGCTTTCAAGTTCAT182,703–182,674164 bp
ProbeTTGCTGGCGCTAAGTTCGTTGGTAGGGAAC [FAM-dT] C [THF] T [BHQ-dT] TTAGCGGGTACCATTA [3′-block]182,584–182,634164 bp
  1. FAM 6-carboxyfluorescein, THF Tetrahydrofuran, BHQ Black hole quencher, C3-spacer 3′-phosphate blocker