Skip to main content

Table 1 Oligonucleotide used as primer for amplification of MPT64 gene PCR

From: Mutation in MPT64 gene influencing diagnostic accuracy of SD Bioline assay (capilia)

GenePrimer sequence(5–3)Product sizeReference
MPT64 forward (MTPF)ACCGAACACTCATTTCCGC771 bpIn this study
MPT64 reverse (MTPR)CTACTCCCGGAGGAATTTCG771 bpIn this study