Skip to main content

Table 1 Primers used for Quantitative Real-Time PCR

From: Inhibition of type I interferon signaling abrogates early Mycobacterium bovis infection

Gene name Forward primer (5′-3′) Reverse primer (5′-3′)
Ifnb1 AAGAGTTACACTGCCTTTGCCAT CACTGTCTGCTGGTGGAGTTCATC
Ifnar1 CTCCATCTCCTGCTTAGTGT ATTAGTTACTGTGGGTACTTGTG
Irf7 ACTTCAGCACTTTCTTCCGAGAAC AGGTAGATGGTGTAGTGTGGTGAC
Oas2 AAAGTCCTGAAGACCGTCAAGGG ACAACAATGTCAGCATCTGATCCC
Igs15 AGCAATGGCCTGGGACCTAAAG AGTCACGGACACCAGGAAATCG
Ifng AGCAACAACATAAGCGTCAT CCTCAAACTTGGCAATACTC
Tnf CAAAATTCGAGTGACAAGCCTGT CCACTTGGTGGTTTGCTACGA
Nos2 TCCTCACGCTTGGGTCTTGTTC TCCAACGTTCTCCGTTCTCTTGC
Mrc1 AATGCCAAAAATTATTGATCGTG ACGGTGACCACTCCTGCTG
Ym1 TACCCTATGCCTATCAGGGTAAT CCTTGAGCCACTGAGCCTTC
Arg1 AATGAAGAGCTGGCCTGGTGTGGT ATGCTTCCAACTGCCAGACTGTG
T-bet CCCCTGTCCAGTCAGTAACTT CTTCTCTGTTTGGCTGGCT
Gata-3 AAGAAAGGCATGAAGGACGC GTGTGCCCATTTGGACATCA
Foxp3 CTTCACCAAGGTGAGCGAGT CTTCTGTCTGGAGTGGCTGG
β-actin CCTTCTGACCCATTCCCACC GCTTCTTTGCAGCTCCTTCG