Skip to main content

Table 1 Primers used for Quantitative Real-Time PCR

From: Inhibition of type I interferon signaling abrogates early Mycobacterium bovis infection

Gene nameForward primer (5′-3′)Reverse primer (5′-3′)
Ifnb1AAGAGTTACACTGCCTTTGCCATCACTGTCTGCTGGTGGAGTTCATC
Ifnar1CTCCATCTCCTGCTTAGTGTATTAGTTACTGTGGGTACTTGTG
Irf7ACTTCAGCACTTTCTTCCGAGAACAGGTAGATGGTGTAGTGTGGTGAC
Oas2AAAGTCCTGAAGACCGTCAAGGGACAACAATGTCAGCATCTGATCCC
Igs15AGCAATGGCCTGGGACCTAAAGAGTCACGGACACCAGGAAATCG
IfngAGCAACAACATAAGCGTCATCCTCAAACTTGGCAATACTC
TnfCAAAATTCGAGTGACAAGCCTGTCCACTTGGTGGTTTGCTACGA
Nos2TCCTCACGCTTGGGTCTTGTTCTCCAACGTTCTCCGTTCTCTTGC
Mrc1AATGCCAAAAATTATTGATCGTGACGGTGACCACTCCTGCTG
Ym1TACCCTATGCCTATCAGGGTAATCCTTGAGCCACTGAGCCTTC
Arg1AATGAAGAGCTGGCCTGGTGTGGTATGCTTCCAACTGCCAGACTGTG
T-betCCCCTGTCCAGTCAGTAACTTCTTCTCTGTTTGGCTGGCT
Gata-3AAGAAAGGCATGAAGGACGCGTGTGCCCATTTGGACATCA
Foxp3CTTCACCAAGGTGAGCGAGTCTTCTGTCTGGAGTGGCTGG
β-actinCCTTCTGACCCATTCCCACCGCTTCTTTGCAGCTCCTTCG
\