Skip to main content

Advertisement

Table 1 PCR primers used in the current study

From: Impact of co-existence of PMQR genes and QRDR mutations on fluoroquinolones resistance in Enterobacteriaceae strains isolated from community and hospital acquired UTIs

Primer namePrimer sequence (5/ to 3/)PCR product size (bp)Annealing TemperatureRef
qnrA m-FAGAGGATTTCTCACGCCAGG58054 °C[16]
qnrA m-RTGCCAGGCACAGATCTTGAC
qnrB m-FGGMATHGAAATTCGCCACTG26454 °C[16]
qnrB m-RTTTGCYGYYCGCCAGTCGAA
qnrS m-FGCAAGTTCATTGAACAGGGT42854 °C[16]
qnrS m-RTCTAAACCGTCGAGTTCGGCG
qnrC-FGGGTTGTACATTTATTGAATC44750 °C[17]
qnrC-RTCCACTTTACGAGGTTCT
qepA-GFACATCTACGGCTTCTTCGTCG50255 °C[18]
qepA-GRAACTGCTTGAGCCCGTAGATC
parC-FATG TAC GTG ATC ATG GAC CG30055 °C[19]
parC-RATT CGG TGT AAC GCA TCG CC
gyrA-FAAA TCT GCC CGT GTC GTT GGT34355 °C[20]
gyrA-RGCC ATA CCT ACG GCG ATA CC