Skip to main content

Table 1 Forward and reverse primers used in the multiplex PCR for Taenia hydatigena, T. multiceps, T. pisiformis, and Dipylidium caninum

From: A multiplex PCR assay for the simultaneous detection of Taenia hydatigena, T. multiceps, T. pisiformis, and Dipylidium caninum infections

Species Primer names and sequences 5′-3’ Expected amplicon size (bp) The location of primers in the mtDNA Accession no. of mtDNAs in NCBI GenBank
T. hydatigena Th-F: AGTTCCATATTATTTACAGTTTTGTTATTAC 592 12,446 NC_012896
Th-R: TAACATAATACTTGAAGACACCCCCA 13,038
T. multiceps Tm-F: GTTGTTGATGTGGCTTAAGTTTTTGTGT 385 10,902 NC_012894
Tm-R: TCTATAAAATAAACACATACACAACAATCCT 11,287
T. pisiformis Tp-F: TGTGGGAAGGTTTAGGTGAATCAT 283 200 NC_013844
Tp-R: GTTAACATCAATATCTTCTAGCTCTGACACT 483
D. caninum Dc-F: CTATTGATTGCGTTTATTGTTTTGTGT 190 8594 MG587892
Dc-R: GAAAAGAAATCAAATACAGTTAAACGGT 8784
  1. Annotation: F, forward primer; R, reverse primer; bp, base pairs