Skip to main content

Advertisement

Table 1 PCR primers used in the study

From: Etiology of childhood diarrhoea among under five children and molecular analysis of antibiotic resistance in isolated enteric bacterial pathogens from a tertiary care hospital, Eastern Odisha, India

GeneSequence (5′-3′)Annealing temp (°C)Amplicon size (bp)
eltCACACGGAGCTCCTCAGTC57508
CCCCCAGCCTAGCTTAGTTT
estGCTAAACCAGTAG/AGGTCTTCAAAA57147
CCCGGTACAG/AGCAGGATTACAACA
bfpAGGAAGTCAAATTCATGGGGG57367
GGAATCAGACGCAGACTGGT
AatACTGGCGAAAGACTGTATCAT57630
CAATGTATAGAAATCCGCTGTT
eaeCCCGAATTCGGCACAAGCATAAGC57881
CCCGGATCCGTCTCGCCAGTATTCG
aaiCATTGTCCTCAGGCATTTCAC57215
ACGACACCCCTGATAAACAA
Stx1CAACACTGGATGATCTCAG57350
CCCCCTCAACTGCTAATA
Stx2ATCAGTCGTCACTCACTGGT57110
CTGCTGTCACAGTGACAAA
blaCTX-M3AATCACTGCGTCAGTTCAC50701
TTTATCCCCCACAACCCAG
NDM-1ACCGCCTGGACCGATGACCA58264
GCCAAAGTTGGGCGCGGTTG
gyrATACACCGGTCAACATTGAGG64648
TTAATGATTGCCGCCGTCGG
gyrBTGAAATGACCCGCCGTAAAGG64309
GCTGTGATAACGCAGTTTGTCCGGG
parCGTCTGAACTGGGCCTGAATGC64249
AGCAGCTCGGAATATTTCGACAA
parEATGCGTGCGGCTAAAAAAGTG64290
TCGTCGCTGTCAGGATCGATAC
qnrAATTTCTCACGCCAGGATTTG64516
GATCGGCAAAGGTTAGGTCA
qnrBGATCGTGAAAGCCAGAAAGG64476
ATGAGCAACGATGCCTGGTA
qnrCGGGTTGTACATTTATTGAATCG64307
CACCTACCCATTTATTTTCA
qnrSGCAAGTTCATTGAACAGGGT64428
TCTAAACCGTCGAGTTCGGCG
aac(6′)-Ib-crTTGCGATGCTCTATGAGTGGCTA55482
CTCGAATGCCTGGCGTGTTT
qepAAACTGCTTGAGCCCGTAGAT55596
GTCTACGCCATGGACCTCAC