Skip to main content

Advertisement

Table 1 Sequences of the qRT-PCR primers

From: Echinococcus multilocularis inoculation induces NK cell functional decrease through high expression of NKG2A in C57BL/6 mice

Gene Forward primer Reverse primer
CD69 TGGTCCTCATCACGTCCTTAATAA TCCAACTTCTCGTACAAGCCTG
NKG2A TTCAGCACAGCCTTGTCCTC CTTCTTTCCAGACCCAGGGC
NKG2D CCAATGTTCGTTGTTCGAGTCC GCACAATACTGGCTGAAACGTC
Ly49G2 TGCCACGATAACTGCAGCC ATGGGTCTTTTGTGAACACCTG
Ly49I GGAACAGTGAAACCAAGACGG CTGTAATGCTGGCAGTTCGC
Ly49D TTCAGGGTTGCAGAACGAGATGAG AGGATCCCGAGAGCTATCACAATG
Ly49H TGGGACAGTGAAACCAAGAGTG GCTGTAATGCTGGCAGTTCG
GAPDH CACTCACGGCAAATTCAACGGCAC GACTCCACGACATACTCAGCAC