Skip to main content

Advertisement

Table 1 Sequences of the primers for multiplex PCR

From: Development of a multiplex PCR to detect and discriminate porcine circoviruses in clinical specimens

Primer Primer sequences (5’-3’) Origin/target gene Location Products
PCV1-F GAAAGTGAGCGGGAAGAT PCV1 (GenBank: KX827790.1) /Rep 499–516 310 bp
PCV1-R CTGATTGCTGGTAATCAA 790–808
PCV2-F CACATCGAGAAAGCGAAAGGAAC PCV2(GenBank: MG229682.1) /Rep 294–316 505 bp
PCV2-R TGCGGGCCAAAAAAGGTACAGTT 776–798
PCV3-F AGCAGTGCTCCCCATTGA PCV3(GenBank: KX898030.1) /Rep, Cap 1431–1448 1021 bp
PCV3-R TGGGCCCGACCAAATCCGG 428–446