Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequences of the primers for multiplex PCR

From: Development of a multiplex PCR to detect and discriminate porcine circoviruses in clinical specimens

Primer Primer sequences (5’-3’) Origin/target gene Location Products
PCV1-F GAAAGTGAGCGGGAAGAT PCV1 (GenBank: KX827790.1) /Rep 499–516 310 bp
PCV2-F CACATCGAGAAAGCGAAAGGAAC PCV2(GenBank: MG229682.1) /Rep 294–316 505 bp
PCV3-F AGCAGTGCTCCCCATTGA PCV3(GenBank: KX898030.1) /Rep, Cap 1431–1448 1021 bp