Skip to main content

Advertisement

Table 1 Primers sequence and annealing tempratures used in this study

From: High incidence of virulence determinants, aminoglycoside and vancomycin resistance in enterococci isolated from hospitalized patients in Northwest Iran

Target Primer sequence (5′ → 3′) Amplicon size (bp) Annealing tempreture Ref.
ddl faecalis ATCAAGTACAGTTAGTCTTTATTAG 941 55 °C [13]
ACGATTCAAAGCTAACTGAATCAGT
ddl faecium TTGAGGCAGACCAGATTGACG 658 55 °C [13]
TATGACAGCGACTCCGATTCC
van A CATGAATAGAATAAAAGTTGCAATA 1030 bp 54 °C [14]
CCCCTTTAACGCTAATACGATCAA
van B GTGACAAACCGGAGGCGAGGA 433 bp 54 °C [14]
CCGCCATCCTCCTGCAAAAAA
van C GAAAGACAACAGGAAGACCGC 796 bp 54 °C [15]
ATCGCATCACAAGCACCAATC
aac(6′)-Ie-aph(2″)-Ia CAGGAATTTATCGAAAATGGTAGAAAAG 369 bp 55 °C [16]
CACAATCGACTAAAGAGTACCAATC
aph(3′)-IIIa GGCTAAAATGAGAATATCACCGG 523 bp 55 °C [16]
CTTTAAAAAATCATACAGCTCGCG
ant(4′)-Ia CAAACTGCTAAATCGGTAGAAGCC 294 bp 55 °C [16]
GGAAAGTTGACCAGACATTACGAACT
aph(2″)-Ic CCACAATGATAATGACTCAGTTCCC 444 bp 55 °C [16]
CCACAGCTTCCGATAGCAAGAG
aph(2″)-Ib CTTGGACGCTGAGATATATGAGCAC 867 bp 55 °C [16]
GTTTGTAGCAATTCAGAAACACCCTT
aph(2″)-Id GTGGTTTTTACAGGAATGCCATC 641 bp 55 °C [16]
CCCTCTTCATACCAATCCATATAACC
ant(3″)-III TGATTTGCTGGTTACGGTGAC 284 bp 55 °C [17]
CGCTATGTTCTCTTGCTTTTG
ant(6′)-Ia ACTGGCTTAATCAATTTGGG 596 bp 55 °C [17]
GCCTTTCCGCCACCTCACCG
PAI GACGCTCCCTTCTTTTGAC 387 bp 54 °C [18]
CCAGAGAAATTACTACCAT
sprE GGTAAACCAACCAAGTGAATC 300 bp 56 °C [18]
TTCTTCCGATTGACGCAAAA
ace CAGGCCAACATCAAGCAACA 125 bp 58 °C [18]
GCTTGCCTCGCCTTCTACAA
gelE CGAAGTTGGAAAAGGAGGC 372 bp 54 °C [18]
GGTGAAGAAGTTACTCTGA
hyl ACAGAAGAGCTGCAGGAAATG 276 bp 55 °C [19]
GACTGACGTCCAAGTTTCCAA
cylA ACTCGGGGATTGATAGGC 688 bp 56 °C [19]
GCTGCTAAAGCTGCGCTT
esp TTTGGGGCAACTGGAATAGT 407 bp 56 °C [18]
CCCAGCAAATAGTCCATCAT