Skip to main content

Table 1 Primers used for Noroviruses genotyping in this study

From: Genetic diversity and epidemiology of Genogroup II noroviruses in children with acute sporadic gastroenteritis in Shanghai, China, 2012–2017

Primers Nucleotide position Polarity Target Sequence (5′- 3′) Size
G2SKF 5058 F Capsid CNTGGGAGGGCGATCGCAA 344 bp
G2SKR 5401 R Capsid CCRCCNGCATRHCCRTTRTACAT  
289H 4865 R RdRp TGACGATTTCATCATCACCATA 331 bp
289I 4865 R RdRp TGACGATTTCATCATCCCCGTA  
290H 4590 F RdRp GATTACTCCAGGTGGGACTCCAC  
290I 4590 F RdRp GATTACTCCAGGTGGGACTCAAC  
290 J 4590 F RdRp GATTACTCCAGGTGGGATTCAAC  
290 K 4590 F RdRp GATTACTCCAGGTGGGATTCCAC