Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequences of primers, probes and standard curves

From: Multiplex qPCR facilitates identification of betaherpesviruses in patients with acute liver failure of unknown etiology

  HCMV Sequence (5′-3′) HHV-6Sequence (5′-3′) HHV-7Sequence (5′-3′)
FAM- VIC- NED –
Probes CCGTATTGGTGCGCGATCTGTTCAA- NFQ-MGB TTAGATGGTGGTGAGCTGGGATCGGT- NFQ-MGB CTCGCAGATTGCTTGTTGGCCATG- NFQ-MGB
Primers (Sense) GGCCGTTACTGTCTGCAGGA AAAGACCTAAATTGCCGCTACCT CGGAAGTCACTGGAGTAATGACAA
Primers (Anti-sense) GGCCTCGTAGTGAAAATTAATGGT GCAAGCTCATGAACATCGTCA CCAATCCTTCCGAAACCGAT
Standard Curve TTCGTGGCCTCGTAGTGAAAATTAATGGTCGTATTTGAACAGATCGCGCACCAATACGGATGCGTTCCTGCAGACAGTAACGGCCCTGATA TTCGTGCAAGCTCATGAACATCGTCACGTATACCGATCCCAGCTCACCACCATCTAAATGCGTAGGTAGCGGCAATTTAGGTCTTTCTGATA TTCGTCCAATCCTTCCGAAACCGATCGTATCATGGCCAACAAGCAATCTGCGAGATGCGTTTGTCATTACTCCAGTGACTTCCGCTGATA