Skip to main content

Table 1 Reverse transcriptional loop-mediated isothermal amplification (RT-LAMP) primers for detection of influenza subtypes

From: Rapid and simple colorimetric detection of multiple influenza viruses infecting humans using a reverse transcriptional loop-mediated isothermal amplification (RT-LAMP) diagnostic platform

Target Gene Primer name Sequence (5′-3′) Primer final concentration
(μM)
Gene position Length
(mer)
B NA B-F3 CAGGAAGAGTAAAACATACTGAGGA 5 856–881 25
B-B3 GATTCGCAAGGCCCTGTT 5 1052–1069 18
B-FIP AGGGTCTTTTTGCTGTGTAACTGTT-GCACATGCGGATTTGCCAG 40 933–955 + 883–901 44
B-BIP GTGGAGACTGATACAGCGGAA-TGCTTCCATCATTTGGTCTGG 40 972–992 + 1030–1050 42
B-LF GATGTCCGTGTAAGATACCAA 10 908–928 21
B-LB ATAAGATTGATGTGCACA 10 993–1010 18
A/H1 HA H1-F3 AGCAAGAAGTTCAAGCCG 5 619–639 18
H1-B3 CGTGAACTGGTGTATCTGAA 5 801–820 20
H1-FIP GGCTCTACTAGTGTCCAGTAATAGT-AAATAGCAATAAGACCCAAAGTG 80 734–758 + 689–711 48
H1-BIP ATAACATTCGAAGCAACTGGAAATC-TGATAATACCAGATCCAGCATT 80 718–742 + 778–799 47
H1-LF TCTCCCTTCTTGATCCC 10 713–729 17
H1-LB TAGTGGTACCGAGATATGCA 10 794–813 20
A/H3 HA H3-F3 GGGGTTACTTCAAAATACG 5 841–859 19
H3-B3 GTTGCCAATTTCAGAGTG 5 1011–1028 18
H3-FIP GAGTGATGCATTCAGAATTGCATTT-TGGGAAAAGCTCAATAATGAGA 40 903–927 + 863–884 47
H3-BIP AATGGAAGCATTCCCAATGACA-GCTTAACATATCTGGGACAGG 40 930–951 + 988–1008 43
H3-LF CCAATGGGTGCATCTGA 10 885–901 17
H3-LB AACCATTCCAAAATGTAAAC 10 952–971 20
A/H5 HA H5-F3 GCTATAGCAGGTTTTATAGAGG 5 1048–1069 22
H5-B3 GCCTCAAACTGAGTGTTCAT 5 1210–1229 20
H5-FIP ACTCCCCTGCTCATTGCTAT-GGATGGCAGGGAATGGTA 80 1112–1131 + 1072–1089 38
H5-BIP GGTACGCTGCAGACAAAGAAT-TGAGTTGACCTTATTGGTGAC 80 1133–1153 + 1177–1197 42
H5-LF CTACCAACCATACCCATGG 5 1093–1114 19
H5-LB CCACTCAAAAGGCAATAGATGGA 5 1154–1176 23
A/H7 HA H7-F3 GCGGGTTTCATTGAAAATGG 5 1036–1055 20
H7-B3 CTACCTCATTGAATTCATTGTCT 5 1215–1237 23
H7-FIP TCCCTCTCCCTGTGCATTCT-ATGGGAAGGCCTAATTGATG 80 1097–1116 + 1056–1075 40
H7-BIP ACTGCTGCAGATTACAAAAGCAC-TGGTTGGTTTTTTCTATAAGCC 80 1117–1139 + 1178–1199 45
H7-LF TCTGAAACCATACCAAC 5 1076–1092 17
H7-LB TCAATCGGCAATTGATCAAATA 5 1140–1161 22