Skip to main content

Table 1 Primers sequences and the annealing temperatures used in this study

From: Virulence characteristics of multidrug resistant biofilm forming Acinetobacter baumannii isolated from intensive care unit patients

Target Genes Primers sequences (5–3) Annealing Temperature(°c) DNA amplicon Size (bp) Reference
epsA AGCAAGTGGTTATCCAATCG ACCAGACTCACCCATTACAT 60 451 [12]
ompA CGCTTCTGCTGGTGCTGAAT CGTGCAGTAGCGTTAGGGTA 58 531 [12]
bla PER-1 ATGAATGTCATTATAAAAGC AATTTGGGCTTAGGGCAAGAAA 55 927 [13]
bap TACTTCCAATCCAATGCTAGGGAGGGTACCAATGCAG TTATCCACTTCCAATGATCAGCAACCAAACCGCTAC 55 1225 [14]
bfmS TTGCTCGAACTTCCAATTTATTATAC TTATGCAGGTGCTTTTTTATTGGTC 60 1428 [14]
ptk GGCTGAGCATCCTGCAATGCGT ACTTCTGGAGAAGGGCCTGCAA 57 597 [15]
pgaB AAGAAAATGCCTGTGCCGACCA GCGAGACCTGCAAAGGGCTGAT 57 490 [15]
fimH TGCAGAACGGATAAGCCGTGG GCAGTCACCTGCCCTCCGGTA 60 870 [16]
csgA ACTCTGACTTGACTATTACC GATGCAGTCTGGTCAAC 50 200 [16]
kpsMII GCGCATTTGCTGATACTGTTG CATCCAGACGATAAGCATGAGCA 58 272 [16]
csuE ATGCATGTTCTCTGGACTGATGTTGAC CGACTTGTACCGTGACCGTATCTTGATAAG 60 976 [17]
intI-1 CAGTGGACATAAGCCTGTTC CCCGAGGCATAGACTGTA 62 160 [18]
intI-2 GTAGCAAACGAGTGACGAAATG CACGGATATGCGACAAAAAGGT 62 788 [18]
intI-3 GCCTCCGGCAGCGACTTTCAG ACGGATCTGCCAAACCTGACT 62 979 [18]