Skip to main content

Advertisement

Table 2 Oligonucleotides used in the development of the assay

From: Use of nanotechnology for infectious disease diagnostics: application in drug resistant tuberculosis

Probe name Description Sequence (5′ to 3′) with modification
CP WT Wild type probe (strip oligo) GATCACCAGCGGCATCGAGAAAAAAAAAA -Biotin
CP ACC Mutation probe (strip oligo) GATCACCACCGGCATCGAGAAAAAAAAAA -Biotin
CP TBD TB detection probe (strip oligo) GGC TGT GGG TAG CAG ACC AAAAAAAAAA -Biotin
CP Control Control probe (strip oligo) CCGTTCGACGGT GCA TCT G AAAAAAAAAA -Biotin
DP TBD TB detection probe (with AuNP) HS-AAAAAAAAAACAGATGCACCGTCGAACGG
DP katG katG detection probe (with AuNP) HS-AAAAAAAAAAGCTGGAGCA GATGGGCTT