Skip to main content

Table 1 Oligonucleotide sequences and locations on the M129 genome

From: Allele-specific real-time PCR testing for minor macrolide-resistant Mycoplasma Pneumoniae

Name Sequence (5′-3′) Position in M129
23S rRNA-F CTTTCTAATGGAGTTTTTTACTT 119,806—119,828
23S rRNA-R GCTTGGTGCTTTCCTATTCT 123,068—123,087
23SA2063G-F GGACGGGAAGACCCCGTGAAGCTTTACT 122,094—122,121
23SA2064G-F GGACGGAGAGACCCCGTGAAGCTTTACT 122,094—122,121
23S2063/2064-R CGTTGCGCCTAACGGGTGTCTTCAC 122,069—122,093
NU-F (Np) TTAGGCGCAACGGGACGG 122,082—122,099
2063MU-F (Msp) TTAGGCGCAACGGGAIIIG 122,082—122,100
2064MU-F (Msp) TTAGGCGCAACGGGAIIIAG 122,082—122,101
23S2063/4D-R CTGGATAACAGTTACCAATTAGAACAGC 122,233—122,260
  1. The target mutations in the primers of sit-directed mutations (23SA2063G-F and 23SA2064G-F) are shown in boldface. The target mutations at the end of the mutant-specific primers (Msp) are shown in boldface and underlined. The internal mismatches in the mutant-specific primers (Msp) are shown in boldface italics