Skip to main content

Table 1 The oligonucleotide primers and probes for real-time PCR used in this study

From: The etiology of acute meningitis and encephalitis syndromes in a sentinel pediatric hospital, Shenzhen, China

Organism Target gene Primer sequence (5′-3′) Probe (5′-3′) Citation
S. pneumoniae lytA F: ACGCAATCTAGCAGATGAAGC
R: TGTTTGGTTGGTTATTCGTGC
FAM-TTTGCCGAAAACGCTTGATACAGGG-BHQ [29]
H. influenzae bexA F: GGCGAAATGGTGCTGGTAA
R: GGCCAAGAGATACTCATAGAACGTT
HEX-CACCACTCATCAAACGAATGAGCGTGG-
BHQ
[29]
GBS cfb F: AGCTCTATTAGAAGTACATGCT
R: CATTTGCTGGGCTTGATTATT
ROX-ATCAAGTGACAACTCCACAAGTGGTAA-
BHQ2
[30]
E. coli uid F: GTGTGATATCTACCCGCTTCGC
R: GAGAACGGTTTGTGGTTAATCAGGA
ROX-TCGGCATCCGGTCAGTGGCAGT-BHQ2 [31]
N. meningitidis ctrA F: GCTGCGGTAGGTGGTTCAA
R: TTGTCGCGGATTTGCAACTA
FAM- CATTGCCACGTGTCAGCTGCACAT-BHQ [32]
L. monocytogenes iap F: CTAAAGCGGGAATCTCCCTT
R: CCATTGTCTTGCGCGTTAAT
HEX- CTTCTGGCGCACAATACGCTAGCACT-
BHQ
[33]
mumps virus Fusion protein F:TCTCACCCATAGCAGGGAGTTATAT
R: GTTAGACTTCGACAGTTTGCAACAA
HEX-AGGCGATTTGTAGCACTGGATGGAACA-
BHQ
[34]
herpes simplex virus polymerase F:CATCACCGACCCGGAGAGGGAC
R: GGGCCAGGCGCTTGTTGGTGTA
FAM- CCGCCGAACTGAGCAGACACCCGCGC-
BHQ
[35]
Japanese encephalitis virus polyprotein F: AGAACGGAAGAYAACCATGACTAAA
R: CCGCGTTTCAGCATATTGAT
ROX-ACCAGGAGGGCCCGG- BHQ2 [36]
enterovirus polyprotein F: CCGGCCCCTGAATGC
R: CACCGGATGGCCAATCCA
ROX-AACCGACTACTTTGGGTGTCCGTGTTTC-
BHQ2
[37]
adenovirus hexon F: GCCACGGTGGGGTTTCTAAACTT
R: GCCCCAGTGGTCTTACATGCACATC
CY5-TGCACCAGACCCGGGCTCAGGTACTCCGA
-BHQ2
[38]
varicella zoster virus DNA polymerase F: CGGCATGGCCCGTCTAT
R: TCGCGTGCTGCGGC
HEX-ATTCAGCAATGGAAACACACGACGCC-
BHQ1
[39]