Skip to main content


Table 1 The oligonucleotide primers and probes for real-time PCR used in this study

From: The etiology of acute meningitis and encephalitis syndromes in a sentinel pediatric hospital, Shenzhen, China

Organism Target gene Primer sequence (5′-3′) Probe (5′-3′) Citation
L. monocytogenes iap F: CTAAAGCGGGAATCTCCCTT
mumps virus Fusion protein F:TCTCACCCATAGCAGGGAGTTATAT
herpes simplex virus polymerase F:CATCACCGACCCGGAGAGGGAC
Japanese encephalitis virus polyprotein F: AGAACGGAAGAYAACCATGACTAAA
enterovirus polyprotein F: CCGGCCCCTGAATGC
varicella zoster virus DNA polymerase F: CGGCATGGCCCGTCTAT