Skip to main content

Table 1 The sequences of used primers

From: Prevalence and genetic diversity of HCV among HIV-1 infected individuals living in Ahvaz, Iran

Name Sequence Nucleotides Orientation Usage
Sc2 GGGAGGTCTCGTAGACCGTGCACCATG 318 → 344 Core/outer Forward
Ac2 GAGCGGGATATACCCCATGAG(A/G)TCGGC 758 → 732 Core/outer Reverse
S7 AGACCGTGCACCATGAGCAC 330 → 349 Core/inner Forward
584 CCCATGAGGTCGGC(A/G)AAGC 749 → 730 Core/inner Reverse
BKP-7 CACTCCCCTGTGAGGAACTACTGTC 38 → 62 5’UTR/outer Forward
BKP-8 ATGGTGCACGGTCTACGAGACCTCC 343 → 319 5’UTR/outer Reverse
BKP-9 TTCACGCAGAAAGCGTCTAGCCATG 63 → 87 5’UTR/inner Forward
BKP-10 GCGCACTCGCAAGCACCCTATCAGG 314 → 292 5’UTR/inner Reverse