Skip to main content

Table 2 Primers used for amplification and sequencing

From: Nosocomial bloodstream infection and the emerging carbapenem-resistant pathogen Ralstonia insidiosa

Primer Sequence (5′ → 3′)
OXA569-up-EcoRI AACGAATTCATGATGAAACTCCGCCACGC
OXA569-down-SacI AACGAGCTCAAATCAGTGACTCGCAAGGGCCA
OXA570-up-EcoRI AACGAATTCATGTTTGCTCGCTGGTCAAA
OXA570-down-SacI AACGAGCTCAAACTAGGGTGTTGGCCACA
OXA573-up-EcoRI AACGAATTCATGTTCCCTCGCTGGTCAAA
OXA573-down-SacI AAAGAGCTCAAACTAGGGTGTTGGCCAC
OXA574-up-EcoRI AACGAATTCATGATGAAACTCCGCCACGC
OXA574-down-XhoI AACCTGCAGAAATCAGTGGCTCGCAAGGGC
M13 R GTAAAACGACGGCCAGT
M13 F CAGGAAACAGCTATGACC
OXA570-RT-F TCAAGCGCACGCCGAGTTGA
OXA570-RT-R GGCACCCGTATCGAAGGC
OXA573-RT-F ATGACCTCAAGCGCGTGTTC
OXA573-RT-R GCACCCGTATCGAAGGC
RpoB-R.in-F GTCCATCAGGTTCCCTTCC
RpoB-R.in-R GGACAGGTGATACGACACGA
  1. aRestriction sites located in primers are underlined