Skip to main content

Table 1 List of primers for PCR and sequencing of pol gene in the study

From: Diversity of HIV-1 genotypes and high prevalence of pretreatment drug resistance in newly diagnosed HIV-infected patients in Shanghai, China

Procedure Name (direction) Sequences(5’-3’) Positiona Length of target fragment
The first round RT-PCR MAW 26 (F) TTGGAAATGTGGAAAGGAAGGAC 2028–2050 1513
RT21 (R) CTGTATTTCTGCTATTAAGTCTTTTGATGGG 3539–3509
The second round PCR PRO-1 (F) CAGAGCCAACAGCCCCACCA 2147–2166 1316
RT20 (R) CTGCCAGTTCTAGCTCTGCTTC 3462–3441
Sequencing PROS3 (F) GCCAACAGCCCCACCA 2151–2166 692
PROC1S (R) GCTGGGTGTGGTATTCC 2842–2826
RTB (F) CCTAGTATAAACAATGAG ACAC 2946–2967 511
RT20S3 (R) GTTCTAGCTCTGCTTC 3456–3441
RTAS (F) CTCAGATTGGTTGCAC 2524–2539 Single-Read Sequencing
  1. aNucleotide positions with reference to the HIV HXB2 strain (Genbank accession number K03455)
  2. F -forward; R-reverse